58 Muridae PPTs View free & download

Order Rodentia Family Muridae PowerPoint PPT Presentation

Order Rodentia Family Muridae - Ears shorter than tail. Eyes, ears visible. Tail naked; annulations visible ... dorsum and slightly lighter venter; naked tail; few hairs on ears (TL 130-200mm) ...

Ears shorter than tail. Eyes, ears visible. Tail naked; annulations visible ... dorsum and slightly lighter venter; naked tail; few hairs on ears (TL 130-200mm) ...

| PowerPoint PPT presentation | free to download

Rodents of Idaho PowerPoint PPT Presentation

Rodents of Idaho - Golden-mantled ground squirrel (Spermophilus lateralis) ... Dark kangaroo rat. Ord's kangaroo rat. Chisel-toothed kangaroo rat. Heteromyidae ...

Golden-mantled ground squirrel (Spermophilus lateralis) ... Dark kangaroo rat. Ord's kangaroo rat. Chisel-toothed kangaroo rat. Heteromyidae ...

| PowerPoint PPT presentation | free to view

Order Lagomorpha Fam' Ochotonidae pikas PowerPoint PPT Presentation

Order Lagomorpha Fam' Ochotonidae pikas - Geomys bursarius Plains pocket gopher. Plains pocket ... African porcupine. Fam. Erethizontidae New World porcupine. Fam. Hydrochoeridae - capybara. Fam. ...

Geomys bursarius Plains pocket gopher. Plains pocket ... African porcupine. Fam. Erethizontidae New World porcupine. Fam. Hydrochoeridae - capybara. Fam. ...

| PowerPoint PPT presentation | free to view

LAGOMORPHS - LAGOMORPHS

LAGOMORPHS

| PowerPoint PPT presentation | free to view

The Owl Pellet PowerPoint PPT Presentation

The Owl Pellet - State what the audience will learn in this session ... Most species of rats are herbivorous, but some are omnivorous. 8/29/09. PLMN. 10. What do I eat? ...

State what the audience will learn in this session ... Most species of rats are herbivorous, but some are omnivorous. 8/29/09. PLMN. 10. What do I eat? ...

| PowerPoint PPT presentation | free to view

BIOSIS Previews (BP) PowerPoint PPT Presentation

BIOSIS Previews (BP) - Title: PowerPoint Author: zhouxuyu Last modified by: LIB Created Date: 12/2/2002 8:41:24 AM Document presentation format:

Title: PowerPoint Author: zhouxuyu Last modified by: LIB Created Date: 12/2/2002 8:41:24 AM Document presentation format:

| PowerPoint PPT presentation | free to view

Gracejose (12) PowerPoint PPT Presentation

Gracejose (12) - Lactoferrin Market

Lactoferrin Market

| PowerPoint PPT presentation | free to download

Rat - Rat Rats are various medium-sized, long-tailed rodents of the superfamily Muroidea.

Rat Rats are various medium-sized, long-tailed rodents of the superfamily Muroidea.

| PowerPoint PPT presentation | free to view

Rodentia - Largest north american rodent Beaver (12-38 kg) Most ... Aplodontidae: Monotypic mountain beaver (Aplodontia rufa) ... Castoridae (beaver): 1 genus; 2 species ...

Largest north american rodent Beaver (12-38 kg) Most ... Aplodontidae: Monotypic mountain beaver (Aplodontia rufa) ... Castoridae (beaver): 1 genus; 2 species ...

| PowerPoint PPT presentation | free to view

Gracejose (11) PowerPoint PPT Presentation

Gracejose (11) - Lactoferrin Market

Lactoferrin Market

| PowerPoint PPT presentation | free to download

Dissection Guide to the Rat PowerPoint PPT Presentation

Dissection Guide to the Rat - Dissection Guide to the Rat The Norway rat (Rattus norvegicus) Rat Dissection Scientific Name: Rattus norvegicus Common Name: Rat Kingdom- Animalia Phylum- Chordata ...

Dissection Guide to the Rat The Norway rat (Rattus norvegicus) Rat Dissection Scientific Name: Rattus norvegicus Common Name: Rat Kingdom- Animalia Phylum- Chordata ...

| PowerPoint PPT presentation | free to download

Rat Dissection Species: Rattus norvegicus - Rat Dissection Species: Rattus norvegicus

Rat Dissection Species: Rattus norvegicus

| PowerPoint PPT presentation | free to download

Top 5 pest issues in Sydney PowerPoint PPT Presentation

Top 5 pest issues in Sydney - Masters Pest Control Sydney, we service Sydney wide for all pest types. Cockroaches, Termites, Spiders, Rats and many more. We’ll price match any comparable pest control quote.

Masters Pest Control Sydney, we service Sydney wide for all pest types. Cockroaches, Termites, Spiders, Rats and many more. We’ll price match any comparable pest control quote.

| PowerPoint PPT presentation | free to download

HAMSTERS - Cages should be at least 10 inches by 16 inches by 10 inches in height. Equipment ... hung inside of the cage, they need to be protected from gnawing by the hamster. ...

Cages should be at least 10 inches by 16 inches by 10 inches in height. Equipment ... hung inside of the cage, they need to be protected from gnawing by the hamster. ...

| PowerPoint PPT presentation | free to view

H A N T A V I R U S Zoonosis Emergente PowerPoint PPT Presentation

H A N T A V I R U S Zoonosis Emergente - Title: Diapositiva 1 Author: Pc Last modified by: Orozco Created Date: 10/21/2006 6:29:59 PM Document presentation format: Presentaci n en pantalla (4:3)

Title: Diapositiva 1 Author: Pc Last modified by: Orozco Created Date: 10/21/2006 6:29:59 PM Document presentation format: Presentaci n en pantalla (4:3)

| PowerPoint PPT presentation | free to download

Dissection Guide to the Rat - Proximal-closer to the the base of a structure. Distal-farther away from a structure ... Using a blunt probe, separate the skin from the muscle. Use scissors ...

Proximal-closer to the the base of a structure. Distal-farther away from a structure ... Using a blunt probe, separate the skin from the muscle. Use scissors ...

| PowerPoint PPT presentation | free to view

Moscow Zoo and its collection of small mammals - Moscow Zoo and its collection of small mammals

Moscow Zoo and its collection of small mammals

| PowerPoint PPT presentation | free to view

Hantavirose - Hantavirose Doen a v rica aguda: Febre hemorr gica com s ndrome renal (HFRS) - sia S ndrome pulmonar por hantavirus (HPS) Am ricas/Brasil Hist rico Hantaan ...

Hantavirose Doen a v rica aguda: Febre hemorr gica com s ndrome renal (HFRS) - sia S ndrome pulmonar por hantavirus (HPS) Am ricas/Brasil Hist rico Hantaan ...

| PowerPoint PPT presentation | free to download

Classification of Animals PowerPoint PPT Presentation

Classification of Animals - These are called common names and they are different for ... For example: mountain lion, cougar and puma are all names commonly used for the same animal. ...

These are called common names and they are different for ... For example: mountain lion, cougar and puma are all names commonly used for the same animal. ...

| PowerPoint PPT presentation | free to view

Rodentia: Gnawing Mammals PowerPoint PPT Presentation

Rodentia: Gnawing Mammals - Beaver. Castor canadensis. our largest rodent ... tapered, hairless, scaly tail differs from beaver's flat tail. Deer Mouse. Peromyscus maniculatus ...

Beaver. Castor canadensis. our largest rodent ... tapered, hairless, scaly tail differs from beaver's flat tail. Deer Mouse. Peromyscus maniculatus ...

| PowerPoint PPT presentation | free to view

Large Herbivorous Mammals: Exotic Species In Northern Australia By: W.J. Freeland PowerPoint PPT Presentation

Large Herbivorous Mammals: Exotic Species In Northern Australia By: W.J. Freeland - Large Herbivorous Mammals: Exotic Species In Northern Australia. By: W.J. Freeland ... The purpose of this article is to examine the effects of man's deliberate ...

Large Herbivorous Mammals: Exotic Species In Northern Australia. By: W.J. Freeland ... The purpose of this article is to examine the effects of man's deliberate ...

| PowerPoint PPT presentation | free to download

?? mouse - 1. Mongolian gerbil : , , , , ...

1. Mongolian gerbil : , , , , ...

| PowerPoint PPT presentation | free to download

Hantavirus Manejo Ambiental PowerPoint PPT Presentation

Hantavirus Manejo Ambiental - Hantavirus Manejo Ambiental Divisi n de Salud Ambiental Noviembre 2001 Prop sito de las Acciones Ambientales Evitar los casos de SCPH, a trav s de la aplicaci n ...

Hantavirus Manejo Ambiental Divisi n de Salud Ambiental Noviembre 2001 Prop sito de las Acciones Ambientales Evitar los casos de SCPH, a trav s de la aplicaci n ...

| PowerPoint PPT presentation | free to view

Eutherian lineages PowerPoint PPT Presentation

Eutherian lineages - food, burrows, caring for queen and her young) grasshopper ... Arvicolinae: North America. voles. Mircotus: lots of species. Phenacomys: heather and tree voles ...

food, burrows, caring for queen and her young) grasshopper ... Arvicolinae: North America. voles. Mircotus: lots of species. Phenacomys: heather and tree voles ...

| PowerPoint PPT presentation | free to view

OVID_BA?? - ... Major Concepts Major Concept Terms Pharmacology Pharmaceuticals Pharmacognosy ... Devonian-; Ordovician-: Paleozoic-; Silurian- 21st century; ...

... Major Concepts Major Concept Terms Pharmacology Pharmaceuticals Pharmacognosy ... Devonian-; Ordovician-: Paleozoic-; Silurian- 21st century; ...

| PowerPoint PPT presentation | free to download

Rodentia and Lagomorpha - Rodentia and Lagomorpha

Rodentia and Lagomorpha

| PowerPoint PPT presentation | free to view

Dipodomys deserti PowerPoint PPT Presentation

Dipodomys deserti - Mojave Mid-Elevation Mixed Desert Scrub ... Ammospermophilus leucurus (White-tailed Antelope Squirrel) Spermophilus tereticaudus (Round-tailed Ground Squirrel) ...

Mojave Mid-Elevation Mixed Desert Scrub ... Ammospermophilus leucurus (White-tailed Antelope Squirrel) Spermophilus tereticaudus (Round-tailed Ground Squirrel) ...

| PowerPoint PPT presentation | free to view

Robert J Robbins PowerPoint PPT Presentation

Robert J Robbins - W3C Workshop on Semantic Web for Life Sciences. Robert J Robbins ... any semantic web for the life sciences, no matter what technology is used, ...

W3C Workshop on Semantic Web for Life Sciences. Robert J Robbins ... any semantic web for the life sciences, no matter what technology is used, ...

| PowerPoint PPT presentation | free to view

Rat Dissection PowerPoint PPT Presentation

Rat Dissection - Cleans up thoroughly and properly stores specimen, returns instruments to their proper place ... www.popsci.com/.../files/articles/rat2.jpg. Skinning ...

Cleans up thoroughly and properly stores specimen, returns instruments to their proper place ... www.popsci.com/.../files/articles/rat2.jpg. Skinning ...

| PowerPoint PPT presentation | free to view

Hantavirose - Hantavirose A doen a Doen a viral aguda, freq entemente fatal; Predominantemente rural e ocupacional; Transmitida por roedores silvestres; - Duas formas cl nicas ...

Hantavirose A doen a Doen a viral aguda, freq entemente fatal; Predominantemente rural e ocupacional; Transmitida por roedores silvestres; - Duas formas cl nicas ...

| PowerPoint PPT presentation | free to download

Rodents Continued: Hamster and Gerbil Managment PowerPoint PPT Presentation

Rodents Continued: Hamster and Gerbil Managment - ... Cannibalism First time dams but also experienced dams Diseases Viral induced lymphoma Hamster polyoma virus DNA virus ... Cancer (rare) Zoonoses ...

... Cannibalism First time dams but also experienced dams Diseases Viral induced lymphoma Hamster polyoma virus DNA virus ... Cancer (rare) Zoonoses ...

| PowerPoint PPT presentation | free to view

Name_______________________ PowerPoint PPT Presentation

Name_______________________ - Name_____ Lab Activity: Classifying Bony Skulls Objective:: You have been assigned a set of 15 mammal skulls. You must classify each and identify the ...

Name_____ Lab Activity: Classifying Bony Skulls Objective:: You have been assigned a set of 15 mammal skulls. You must classify each and identify the ...

| PowerPoint PPT presentation | free to view

Development of a quantitative real time PCR assay for the detection of B. burgdorferi sensu lato in clinical samples M. Schwaiger, S. Nigg, G. Siegl, P. Cassinotti Institute for Clinical Microbiology and Immunology, St. Gallen, Switzerland - FIRST HUMAN CASE OF HANTA VIRUS INFECTION IN SWITZERLAND D. Schultze 1, . Lundkvist 2, U. Blauenstein 3, P. Heyman 4 1 Institute for Clinical Microbiology and ...

FIRST HUMAN CASE OF HANTA VIRUS INFECTION IN SWITZERLAND D. Schultze 1, . Lundkvist 2, U. Blauenstein 3, P. Heyman 4 1 Institute for Clinical Microbiology and ...

| PowerPoint PPT presentation | free to download

EMBASE?BA????? PowerPoint PPT Presentation

EMBASE?BA????? - Title: EMBase BA Author: Last modified by: zhangbin Created Date: 10/27/2003 1:51:29 AM Document presentation format:

Title: EMBase BA Author: Last modified by: zhangbin Created Date: 10/27/2003 1:51:29 AM Document presentation format:

| PowerPoint PPT presentation | free to view

Biogeographic subdivisions of the earth PowerPoint PPT Presentation

Biogeographic subdivisions of the earth - ... are the North American deserts: Chihuahuan. Sonoran. Mojave ... Mammal families in red. Flowering plant families in blue. Biogeographical provincialism ...

... are the North American deserts: Chihuahuan. Sonoran. Mojave ... Mammal families in red. Flowering plant families in blue. Biogeographical provincialism ...

| PowerPoint PPT presentation | free to view

Rodentia Part Deu PowerPoint PPT Presentation

Rodentia Part Deu - ... bouldery areas, and rocky slopes from Utah to T-P Tx, s to Sonora and Chihuahua ... soil with spare vegetation from SE New Mexico and TX S to Chihuahua, Mexico. ...

... bouldery areas, and rocky slopes from Utah to T-P Tx, s to Sonora and Chihuahua ... soil with spare vegetation from SE New Mexico and TX S to Chihuahua, Mexico. ...

| PowerPoint PPT presentation | free to download

Hantavirus - (Original image kindly provided by Dr. Simmons of U. Missouri) Panhandle Structure ... Believed to be initiation signals for transcription and gene expression. ...

(Original image kindly provided by Dr. Simmons of U. Missouri) Panhandle Structure ... Believed to be initiation signals for transcription and gene expression. ...

| PowerPoint PPT presentation | free to download

Biology 2900 Evolution and Systematics - Biology 2900 Evolution and Systematics

Biology 2900 Evolution and Systematics

| PowerPoint PPT presentation | free to view

Classifying - Scientists needed a way to classify them for study and a way to ... Museum of Paleontology, University of California at Berkeley. B. eubacteria -common bacteria ...

Scientists needed a way to classify them for study and a way to ... Museum of Paleontology, University of California at Berkeley. B. eubacteria -common bacteria ...

| PowerPoint PPT presentation | free to view

Whats the deal with this Hantavirus Ive been hearing about PowerPoint PPT Presentation

Whats the deal with this Hantavirus Ive been hearing about - Peromyscus maniculatus or deer mouse. Sigmodon hispidus or cotton rat ... infected from a mouse bite ... Hantavirus is usually spread by deer mouse feces ...

Peromyscus maniculatus or deer mouse. Sigmodon hispidus or cotton rat ... infected from a mouse bite ... Hantavirus is usually spread by deer mouse feces ...

| PowerPoint PPT presentation | free to view

Molecular Clocks PowerPoint PPT Presentation

Molecular Clocks - Evolution at the molecular level is radically different from evolution at the ... Darwin's theory reinterpreted homology as common ancestry. ATCGGCCACTTTCGCGATCA ...

Evolution at the molecular level is radically different from evolution at the ... Darwin's theory reinterpreted homology as common ancestry. ATCGGCCACTTTCGCGATCA ...

| PowerPoint PPT presentation | free to view

ISSUES IN SMALL ORGANIC MOLECULES PowerPoint PPT Presentation

ISSUES IN SMALL ORGANIC MOLECULES - Small Molecule Examples 'Markush' claims. Combinatorial Chemistry-small ... Barnard et al. 'Use of Markush structure analysis techniques for descriptor ...

Small Molecule Examples 'Markush' claims. Combinatorial Chemistry-small ... Barnard et al. 'Use of Markush structure analysis techniques for descriptor ...

| PowerPoint PPT presentation | free to download

III Alineamiento de Secuencias PowerPoint PPT Presentation

III Alineamiento de Secuencias - III Alineamiento de Secuencias Andr s Moreira Departamento de Inform tica UTFSM Comparaci n de secuencias Comparaci n de secuencias Comparaci n de secuencias ...

III Alineamiento de Secuencias Andr s Moreira Departamento de Inform tica UTFSM Comparaci n de secuencias Comparaci n de secuencias Comparaci n de secuencias ...

| PowerPoint PPT presentation | free to view

Classification of Birds and Mammals PowerPoint PPT Presentation

Classification of Birds and Mammals - Kingdom : Animalia Phylum : Chordata Class : Mammalia Order : Artiodactyla Family : Bovidae Genus : Ovis Species : O. orientalis vignei ...

Kingdom : Animalia Phylum : Chordata Class : Mammalia Order : Artiodactyla Family : Bovidae Genus : Ovis Species : O. orientalis vignei ...

| PowerPoint PPT presentation | free to view

Searching BIOSIS Previews PowerPoint PPT Presentation

Searching BIOSIS Previews - hematology in MC. medical sciences in MC. pharmacology in MC. Display example. Infection-; Hematology- (Human-Medicine, Medical-Sciences); Pharmacology ...

hematology in MC. medical sciences in MC. pharmacology in MC. Display example. Infection-; Hematology- (Human-Medicine, Medical-Sciences); Pharmacology ...

| PowerPoint PPT presentation | free to view

Rodentia Part I R.O.U.S. PowerPoint PPT Presentation

Rodentia Part I R.O.U.S. - Skulls. A. inter: Aud bul large (1 length molar row), 1st premolar (P3) minute or absent ... Skulls. N. cin: M1 w/ deep anterio-internal angle, M3 with ...

Skulls. A. inter: Aud bul large (1 length molar row), 1st premolar (P3) minute or absent ... Skulls. N. cin: M1 w/ deep anterio-internal angle, M3 with ...

| PowerPoint PPT presentation | free to download

Correlation Analyses of Rodents, Precipitation, and NDVI from Six Localities on the Sevilleta Nation - Correlation Analyses of Rodents, Precipitation, and NDVI from Six Localities on the Sevilleta Nation

Correlation Analyses of Rodents, Precipitation, and NDVI from Six Localities on the Sevilleta Nation

| PowerPoint PPT presentation | free to view

Extending Traditional QueryBased Integration Approaches for Functional Characterization of PostGenom PowerPoint PPT Presentation

Extending Traditional QueryBased Integration Approaches for Functional Characterization of PostGenom - splicing exons into putative coding sequences. extracting putative donor and acceptor sites ... Interrogate putative primary structure in genomic sequence ' ...

splicing exons into putative coding sequences. extracting putative donor and acceptor sites ... Interrogate putative primary structure in genomic sequence ' ...

| PowerPoint PPT presentation | free to view

EMBASE?BA????? - ... Major Concepts Major Concept Terms Pharmacology Pharmaceuticals Pharmacognosy ... Devonian-; Ordovician-: Paleozoic-; Silurian- 21st century; ...

... Major Concepts Major Concept Terms Pharmacology Pharmaceuticals Pharmacognosy ... Devonian-; Ordovician-: Paleozoic-; Silurian- 21st century; ...

| PowerPoint PPT presentation | free to view

Mamferos del Per PowerPoint PPT Presentation

Mamferos del Per - Se alimentan de insectos, lombrices, vegetaci n, hongos y semillas ... Habitan desiertos, bosque seco, bosque premontano, montano y bosque h medo tropical. ...

Se alimentan de insectos, lombrices, vegetaci n, hongos y semillas ... Habitan desiertos, bosque seco, bosque premontano, montano y bosque h medo tropical. ...

| PowerPoint PPT presentation | free to view

Concept and Theme Discovery through Probabilistic Models and Clustering PowerPoint PPT Presentation

Concept and Theme Discovery through Probabilistic Models and Clustering - mite. mites. jacobsoni. acarina. brood. parasite. colonies. host. control. chelicerata. chelicerates ... mite. mites. jacobsoni. acarina. brood. parasite ...

mite. mites. jacobsoni. acarina. brood. parasite. colonies. host. control. chelicerata. chelicerates ... mite. mites. jacobsoni. acarina. brood. parasite ...

| PowerPoint PPT presentation | free to view

Supporting on-the-fly data Integration for bioinformatics PowerPoint PPT Presentation

Supporting on-the-fly data Integration for bioinformatics - ... Data mining algorithms for semi-automatic writing Reusable by different requests on same data Code generation Request analysis ... Phylip Raw RSF ... sequence ...

... Data mining algorithms for semi-automatic writing Reusable by different requests on same data Code generation Request analysis ... Phylip Raw RSF ... sequence ...

| PowerPoint PPT presentation | free to view

http:creativecommons'orglicensesbysa2'0 PowerPoint PPT Presentation

http:creativecommons'orglicensesbysa2'0 - All s which are different then what you have in your binder ... Sequin (NCBI) PseudoCAP (SFU) GMOD (CSHL) Pegasys (UBiC) Apollo (EBI/Berkeley) Lecture 4.2 ...

All s which are different then what you have in your binder ... Sequin (NCBI) PseudoCAP (SFU) GMOD (CSHL) Pegasys (UBiC) Apollo (EBI/Berkeley) Lecture 4.2 ...

| PowerPoint PPT presentation | free to view

Mountain Lion Felis concolor Family: Felidae, Order: Carnivora PowerPoint PPT Presentation

Mountain Lion Felis concolor Family: Felidae, Order: Carnivora - Fun Facts: largest of the small ... Prey Sources/Eating Habits: edges of leaves, nectar Predators: human gatherers/collectors, some spiders and birds Fun Facts: ...

Fun Facts: largest of the small ... Prey Sources/Eating Habits: edges of leaves, nectar Predators: human gatherers/collectors, some spiders and birds Fun Facts: ...

| PowerPoint PPT presentation | free to view

Mountain Lion Felis concolor Family: Felidae, Order: Carnivora - ... desert to tundra, ... desert-like to alpine/boreal ... third largest ungulate in North America (bison, moose, elk), largest on Colorado Plateau (now ...

... desert to tundra, ... desert-like to alpine/boreal ... third largest ungulate in North America (bison, moose, elk), largest on Colorado Plateau (now ...

| PowerPoint PPT presentation | free to view

P1252109262Nnwkx PowerPoint PPT Presentation

P1252109262Nnwkx - Managing Director of Compass Insurance. Company Limited ... Alta Mar . Head: Wealth Retail Investment. Momentum. Zinhle Mdlalose. Group Legal Advisor ...

Managing Director of Compass Insurance. Company Limited ... Alta Mar . Head: Wealth Retail Investment. Momentum. Zinhle Mdlalose. Group Legal Advisor ...

| PowerPoint PPT presentation | free to view

Muridae PowerPoint PPT Presentations