Genebank PowerPoint PPT Presentations

All Time
Show:
Recommended
Sort by:
Crop Genebank Knowledge Base PowerPoint PPT Presentation
Crop Genebank Knowledge Base - Crop Genebank Knowledge Base An initiative of the CGIAR System-wide Genetic Resources Programme, financed by the World Bank and coordinated by Bioversity International
Crop Genebank Knowledge Base An initiative of the CGIAR System-wide Genetic Resources Programme, financed by the World Bank and coordinated by Bioversity International
| PowerPoint PPT presentation | free to download
International Crop Genebanks PowerPoint PPT Presentation
International Crop Genebanks - aesthetic, cultural, ecological, economic, educational, ... Bouak , Cote d'Ivoire. Rice. 14,917. World Agroforesty Centre. Nairobi, Kenya. Sesbania ...
aesthetic, cultural, ecological, economic, educational, ... Bouak , Cote d'Ivoire. Rice. 14,917. World Agroforesty Centre. Nairobi, Kenya. Sesbania ...
| PowerPoint PPT presentation | free to view
Seed Genebank Conservation PowerPoint PPT Presentation
Seed Genebank Conservation - Seed Genebank Conservation
Seed Genebank Conservation
| PowerPoint PPT presentation | free to view
Division 2: Genetic Resources Conservation and Characterization State of the Genebank PowerPoint PPT Presentation
Division 2: Genetic Resources Conservation and Characterization State of the Genebank - Division 2: Genetic Resources Conservation and Characterization State of the Genebank
Division 2: Genetic Resources Conservation and Characterization State of the Genebank
| PowerPoint PPT presentation | free to view
Safeguarding Genetic Diversity the role of ex situ conservation and genebanks in food security PowerPoint PPT Presentation
Safeguarding Genetic Diversity the role of ex situ conservation and genebanks in food security - Genetic diversity and its importance for sustainable development ... Endowment fund proceeds will support the long-term maintenance of key national ...
Genetic diversity and its importance for sustainable development ... Endowment fund proceeds will support the long-term maintenance of key national ...
| PowerPoint PPT presentation | free to view
GRIN-Global Project PowerPoint PPT Presentation
GRIN-Global Project - GRIN-Global Project the global plant genebank information management system GRIN-Global Search Tool Windows application for performing searches of GRIN-Global data.
GRIN-Global Project the global plant genebank information management system GRIN-Global Search Tool Windows application for performing searches of GRIN-Global data.
| PowerPoint PPT presentation | free to view
Procedure for Germplasm Exchange PowerPoint PPT Presentation
Procedure for Germplasm Exchange - Genetic Resources Center (Genebank) - traditional varieties, wild relatives of rice ... Blast, Bacterial Blight, BPH, Gall midge. Soil stress, cold stress ...
Genetic Resources Center (Genebank) - traditional varieties, wild relatives of rice ... Blast, Bacterial Blight, BPH, Gall midge. Soil stress, cold stress ...
| PowerPoint PPT presentation | free to view
AHM 2002 PowerPoint PPT Presentation
AHM 2002 - an external program to build a model or. back to blast to find additional matches, or ... OUTPUT: collection of clustered cDNA fragments. NCBI GeneBank ...
an external program to build a model or. back to blast to find additional matches, or ... OUTPUT: collection of clustered cDNA fragments. NCBI GeneBank ...
| PowerPoint PPT presentation | free to download
A. I. ZAVRAS1, T. WU2, C. W. DOUGLAS1, L. SIROTA2, S. R. DIEHL2. PowerPoint PPT Presentation
A. I. ZAVRAS1, T. WU2, C. W. DOUGLAS1, L. SIROTA2, S. R. DIEHL2. - Over 50% of the tendencies to use tobacco and alcohol are linked to heritabilities. ... polymorphisms at position 50 (clone pADH36, genebank accession number AF040967) ...
Over 50% of the tendencies to use tobacco and alcohol are linked to heritabilities. ... polymorphisms at position 50 (clone pADH36, genebank accession number AF040967) ...
| PowerPoint PPT presentation | free to view
Institute of Biodiversity Conservation IBC PowerPoint PPT Presentation
Institute of Biodiversity Conservation IBC - Ethiopia, Centre of Origin and/or diversity of species due ... Genebank and Herbarium Service. Information and Documentation Service. Other Supportive Services ...
Ethiopia, Centre of Origin and/or diversity of species due ... Genebank and Herbarium Service. Information and Documentation Service. Other Supportive Services ...
| PowerPoint PPT presentation | free to view
International Information Networking PowerPoint PPT Presentation
International Information Networking - An accession-level window, not a meta-data database ... Royalty free package, time for installation between. 1h to... 1 day... Genebank. database ...
An accession-level window, not a meta-data database ... Royalty free package, time for installation between. 1h to... 1 day... Genebank. database ...
| PowerPoint PPT presentation | free to view
GRIN-Global Suite of Software Components PowerPoint PPT Presentation
GRIN-Global Suite of Software Components - GRIN-Global Suite of Software Components
GRIN-Global Suite of Software Components
| PowerPoint PPT presentation | free to view
Biodiversity research and informatics in Bioversity International PowerPoint PPT Presentation
Biodiversity research and informatics in Bioversity International - Not just a result of natural selection, it is the result of thousands of years ... Soviet botanist and geneticist. value of genetic diversity in ...
Not just a result of natural selection, it is the result of thousands of years ... Soviet botanist and geneticist. value of genetic diversity in ...
| PowerPoint PPT presentation | free to view
Text for Supplementary Figures: PowerPoint PPT Presentation
Text for Supplementary Figures: - Title: Slide 1 Document presentation format: Custom Other titles: DejaVu Sans Wingdings Symbol Times New Roman Arial Default Design Slide 1 Slide 2 Slide 3 Slide 4 ...
Title: Slide 1 Document presentation format: Custom Other titles: DejaVu Sans Wingdings Symbol Times New Roman Arial Default Design Slide 1 Slide 2 Slide 3 Slide 4 ...
| PowerPoint PPT presentation | free to download
Exchange of germplasm datasets with PyWrapper/BioCASE PowerPoint PPT Presentation
Exchange of germplasm datasets with PyWrapper/BioCASE - Dag Endresen, Nordic Gene Bank. Johan B ckman, Nordic Gene Bank. Helmut Kn pffer, IPK Gatersleben ... Exchange of germplasm datasets with PyWrapper/BioCASE, ...
Dag Endresen, Nordic Gene Bank. Johan B ckman, Nordic Gene Bank. Helmut Kn pffer, IPK Gatersleben ... Exchange of germplasm datasets with PyWrapper/BioCASE, ...
| PowerPoint PPT presentation | free to view
GenBank PowerPoint PPT Presentation
GenBank - Data shared nightly among three collaborating databases ... Taxonomy. PubMed abstracts. Nucleotide sequences. Protein sequences. 3-D Structure. 3 -D Structure ...
Data shared nightly among three collaborating databases ... Taxonomy. PubMed abstracts. Nucleotide sequences. Protein sequences. 3-D Structure. 3 -D Structure ...
| PowerPoint PPT presentation | free to download
GENBANK, SWISSPROT AND OTHERS PowerPoint PPT Presentation
GENBANK, SWISSPROT AND OTHERS - GENBANK, SWISSPROT AND OTHERS As Problem Sources for CSE 549 Andriy Tovkach Genetics GENBANK OVERVIEW Consists of EMBL, NCBI and DDBJ Started 10 years ago Exponential ...
GENBANK, SWISSPROT AND OTHERS As Problem Sources for CSE 549 Andriy Tovkach Genetics GENBANK OVERVIEW Consists of EMBL, NCBI and DDBJ Started 10 years ago Exponential ...
| PowerPoint PPT presentation | free to download
The National Plant Germplasm System: Status and Prospects PowerPoint PPT Presentation
The National Plant Germplasm System: Status and Prospects - The National Plant Germplasm System: Status and Prospects Peter Bretting USDA/ARS Office of National Programs The USDA/ARS National Plant Germplasm System (NPGS) One ...
The National Plant Germplasm System: Status and Prospects Peter Bretting USDA/ARS Office of National Programs The USDA/ARS National Plant Germplasm System (NPGS) One ...
| PowerPoint PPT presentation | free to view
Genetic Resources in CIMMYT Development of Generic GRIMS PowerPoint PPT Presentation
Genetic Resources in CIMMYT Development of Generic GRIMS - Genetic Resources in CIMMYT Development of Generic GRIMS Juan Carlos Alarc n M. Crop Informatics Specialist - Genetic Resources (CIMMYT) Crop Research Informatics ...
Genetic Resources in CIMMYT Development of Generic GRIMS Juan Carlos Alarc n M. Crop Informatics Specialist - Genetic Resources (CIMMYT) Crop Research Informatics ...
| PowerPoint PPT presentation | free to view
Introduction of LacNatRes Final meeting GENEMINE Rome, 2462004 PowerPoint PPT Presentation
Introduction of LacNatRes Final meeting GENEMINE Rome, 2462004 - molecular characterisation. data analysis. publication of results ... WP E4: most challenging. relationship with former EU lettuce project ...
molecular characterisation. data analysis. publication of results ... WP E4: most challenging. relationship with former EU lettuce project ...
| PowerPoint PPT presentation | free to view
Orientation to the National Plant Germplasm System: Meeting the Nation PowerPoint PPT Presentation
Orientation to the National Plant Germplasm System: Meeting the Nation - Partnerships with other Federal agencies, universities and industry ... NGRL: GRIN database; exploration; germplasm quarantine ...
Partnerships with other Federal agencies, universities and industry ... NGRL: GRIN database; exploration; germplasm quarantine ...
| PowerPoint PPT presentation | free to view
The top 20 crops: their ex situ collections in view of climate change PowerPoint PPT Presentation
The top 20 crops: their ex situ collections in view of climate change - Centre for Genetic Resources, the Netherlands. The top 20 crops: ... Centre for Genetic Resources, the Netherlands. Threats and demands from climate change (1) ...
Centre for Genetic Resources, the Netherlands. The top 20 crops: ... Centre for Genetic Resources, the Netherlands. Threats and demands from climate change (1) ...
| PowerPoint PPT presentation | free to view
Plant Breeding PowerPoint PPT Presentation
Plant Breeding - Type and Acquiring of Genetic Resources. Use of Genetic Resources in Plant Breeding ... Enza Zaden is a family owned vegetable breeding. company ...
Type and Acquiring of Genetic Resources. Use of Genetic Resources in Plant Breeding ... Enza Zaden is a family owned vegetable breeding. company ...
| PowerPoint PPT presentation | free to view
SEED PROCESSING: MANAGEMENT TECHNIQUES PowerPoint PPT Presentation
SEED PROCESSING: MANAGEMENT TECHNIQUES - Debris and damaged seeds can spread ... Carefully pour the mixture into petri dishes by lifting the lid enough only to ... microbiology, chemistry and ...
Debris and damaged seeds can spread ... Carefully pour the mixture into petri dishes by lifting the lid enough only to ... microbiology, chemistry and ...
| PowerPoint PPT presentation | free to view
IRRI Genetic Resources Information Management System GRIMS PowerPoint PPT Presentation
IRRI Genetic Resources Information Management System GRIMS - ... of IRGC accession number and designation of MLS/FAO dates ... Uses GMS Search for finding an accession and all relevant information attached to it ...
... of IRGC accession number and designation of MLS/FAO dates ... Uses GMS Search for finding an accession and all relevant information attached to it ...
| PowerPoint PPT presentation | free to view
Riso PowerPoint PPT Presentation
Riso - Riso Un antica leggenda coreana narra che tutte le mattine un chicco di riso compariva sul focolare della moglie del contadino, s infilava nella pentola e la ...
Riso Un antica leggenda coreana narra che tutte le mattine un chicco di riso compariva sul focolare della moglie del contadino, s infilava nella pentola e la ...
| PowerPoint PPT presentation | free to view
Investigation of the phylogenetic relationships within the genus Bartonella based on comparative seq PowerPoint PPT Presentation
Investigation of the phylogenetic relationships within the genus Bartonella based on comparative seq - What is the phylogeny of species of Bartonella? ... In MacClade, the different specie's gene sequences were aligned with the most ...
What is the phylogeny of species of Bartonella? ... In MacClade, the different specie's gene sequences were aligned with the most ...
| PowerPoint PPT presentation | free to view
Creative biogene-The Extended Applications of RNAi PowerPoint PPT Presentation
Creative biogene-The Extended Applications of RNAi - The Extended Applications of RNAi from Creative Biogene.
The Extended Applications of RNAi from Creative Biogene.
| PowerPoint PPT presentation | free to download
Genetic Diversity in Crop PowerPoint PPT Presentation
Genetic Diversity in Crop - Genetic Diversity in Crop
Genetic Diversity in Crop
| PowerPoint PPT presentation | free to view
The National Plant Germplasm System: Current Status and Future Prospects PowerPoint PPT Presentation
The National Plant Germplasm System: Current Status and Future Prospects - The National Plant Germplasm System: Current Status and Future Prospects Peter Bretting USDA/ARS Office of National Programs The USDA/ARS National Plant Germplasm ...
The National Plant Germplasm System: Current Status and Future Prospects Peter Bretting USDA/ARS Office of National Programs The USDA/ARS National Plant Germplasm ...
| PowerPoint PPT presentation | free to view
Advances and Strategies for Agriculture Research in China PowerPoint PPT Presentation
Advances and Strategies for Agriculture Research in China - Advances and Strategies for Agriculture Research in China
Advances and Strategies for Agriculture Research in China
| PowerPoint PPT presentation | free to download
African Regional Expert Workshop on Sustainable Use of Biodiversity Nairobi, 12 -15 December 2006 PowerPoint PPT Presentation
African Regional Expert Workshop on Sustainable Use of Biodiversity Nairobi, 12 -15 December 2006 - High nutritional value (Vit A, Dietary fiber) Prime source of carbohydrates ... Localized market and varies quality of traditional products ...
High nutritional value (Vit A, Dietary fiber) Prime source of carbohydrates ... Localized market and varies quality of traditional products ...
| PowerPoint PPT presentation | free to download
Session 10 : Phytosanitary and Biosafety Measures PowerPoint PPT Presentation
Session 10 : Phytosanitary and Biosafety Measures - Title: Biosafety and the Cartagena protocol Author: OEM Last modified by: Jef Created Date: 7/20/2004 7:19:05 PM Document presentation format: On-screen Show
Title: Biosafety and the Cartagena protocol Author: OEM Last modified by: Jef Created Date: 7/20/2004 7:19:05 PM Document presentation format: On-screen Show
| PowerPoint PPT presentation | free to download
The Cell, Central Dogma and Human Genome Project PowerPoint PPT Presentation
The Cell, Central Dogma and Human Genome Project - The Cell, Central Dogma and. Human Genome Project. A Eukaryotic Cell ... (How Perl saved the Human Genome project?) Major Database and Data collection methods: ...
The Cell, Central Dogma and. Human Genome Project. A Eukaryotic Cell ... (How Perl saved the Human Genome project?) Major Database and Data collection methods: ...
| PowerPoint PPT presentation | free to download
AGRICULTURE PowerPoint PPT Presentation
AGRICULTURE - Species-related databases, information systems and inventories of cultivated and ... Existing databases: LEDA Trait base. Traditional knowledge ...
Species-related databases, information systems and inventories of cultivated and ... Existing databases: LEDA Trait base. Traditional knowledge ...
| PowerPoint PPT presentation | free to view
How to use the web for bioinformatics PowerPoint PPT Presentation
How to use the web for bioinformatics - JOURNAL. FEATURES - A complete list of all of the features of a sequence. ... Change to Courier or Courier New. Reduce Font Size. Change to Landscape view. PCR ...
JOURNAL. FEATURES - A complete list of all of the features of a sequence. ... Change to Courier or Courier New. Reduce Font Size. Change to Landscape view. PCR ...
| PowerPoint PPT presentation | free to download
????????? ?????? Services and Resources of the National Library of Medicine PowerPoint PPT Presentation
????????? ?????? Services and Resources of the National Library of Medicine - Title: NLM Author: tmu Last modified by: tzchiu Created Date: 7/29/2003 5:03:53 AM Document presentation format
Title: NLM Author: tmu Last modified by: tzchiu Created Date: 7/29/2003 5:03:53 AM Document presentation format
| PowerPoint PPT presentation | free to download
DNA Sequence Analysis PowerPoint PPT Presentation
DNA Sequence Analysis - Do we have a full length clone with an identifiable start and stop codon? ... Begin with 'ATG' start codon. End with 'TAA', 'TAG', or 'TGA' stop codons ...
Do we have a full length clone with an identifiable start and stop codon? ... Begin with 'ATG' start codon. End with 'TAA', 'TAG', or 'TGA' stop codons ...
| PowerPoint PPT presentation | free to view
Investigating Gene Regulation using pGLO Plasmid PowerPoint PPT Presentation
Investigating Gene Regulation using pGLO Plasmid - Investigating Gene Regulation using pGLO Plasmid
Investigating Gene Regulation using pGLO Plasmid
| PowerPoint PPT presentation | free to view
? ? ? ? ? Bioinformatics PowerPoint PPT Presentation
? ? ? ? ? Bioinformatics - Bioinformatics Bioscau@21cn.com yahoo.com.cn ...
Bioinformatics Bioscau@21cn.com yahoo.com.cn ...
| PowerPoint PPT presentation | free to view
Gy PowerPoint PPT Presentation
Gy - Gy rgyi Bela; Institute of Environmental Management, St. Istv n University, G d ll , Hungary Gy rgy Pataki; Institute of Environmental Management, St. Istv n ...
Gy rgyi Bela; Institute of Environmental Management, St. Istv n University, G d ll , Hungary Gy rgy Pataki; Institute of Environmental Management, St. Istv n ...
| PowerPoint PPT presentation | free to view
Creative biogene-The Extended Applications of RNAi (1) PowerPoint PPT Presentation
Creative biogene-The Extended Applications of RNAi (1) - The Extended Applications of RNAi from Creative Biogene.
The Extended Applications of RNAi from Creative Biogene.
| PowerPoint PPT presentation | free to download
The Estonian National Inventory PowerPoint PPT Presentation
The Estonian National Inventory - ESTONIA. Building a National Inventory. The Estonian National Inventory ... of plant genetic resources in Estonia were initiated in co-operation with the ...
ESTONIA. Building a National Inventory. The Estonian National Inventory ... of plant genetic resources in Estonia were initiated in co-operation with the ...
| PowerPoint PPT presentation | free to view
gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta PowerPoint PPT Presentation
gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta - Title: 1 Author: Rahmaninova Last modified by: ravcheyev Created Date: 2/9/2006 1:13:17 PM Document presentation format: On-screen Show Company
Title: 1 Author: Rahmaninova Last modified by: ravcheyev Created Date: 2/9/2006 1:13:17 PM Document presentation format: On-screen Show Company
| PowerPoint PPT presentation | free to download
Folie 1 PowerPoint PPT Presentation
Folie 1 - Compilation of 9 regional conservation strategies, - Compilations of currently 16 Global Crop Conservation Strategies exclusively for ' ...
Compilation of 9 regional conservation strategies, - Compilations of currently 16 Global Crop Conservation Strategies exclusively for ' ...
| PowerPoint PPT presentation | free to view
Establishment of an European Plant Genetic Resources Information InfraStructure EPGRIS PowerPoint PPT Presentation
Establishment of an European Plant Genetic Resources Information InfraStructure EPGRIS - kind of documentation. technical infrastructure. amount and structure of data ... Creating a National Inventory - fourth step. validation / harmonisation / updating ...
kind of documentation. technical infrastructure. amount and structure of data ... Creating a National Inventory - fourth step. validation / harmonisation / updating ...
| PowerPoint PPT presentation | free to view
Key Innovations in Biodiversity PowerPoint PPT Presentation
Key Innovations in Biodiversity - Development of low cost standards and protocols (software in the public domain, ... in biodiversity information management (BINBr www.binbr.org.br; Biota-SP ...
Development of low cost standards and protocols (software in the public domain, ... in biodiversity information management (BINBr www.binbr.org.br; Biota-SP ...
| PowerPoint PPT presentation | free to view
1. dia PowerPoint PPT Presentation
1. dia - Univ. of Szeged, Med. Biol. Inst., Mol- and cellbiol. pract., VIII. The isolation of inheritance material Cell lysis Isolation of genom DNA Isolation of RNA
Univ. of Szeged, Med. Biol. Inst., Mol- and cellbiol. pract., VIII. The isolation of inheritance material Cell lysis Isolation of genom DNA Isolation of RNA
| PowerPoint PPT presentation | free to view
David M' Brenner Curator North Central Regional Plant Introduction Station PowerPoint PPT Presentation
David M' Brenner Curator North Central Regional Plant Introduction Station - Summer dormant warm moist. Fire fire or smoke ... (Apiaceae), a winter annual of the North American Eastern Deciduous Forest. ...
Summer dormant warm moist. Fire fire or smoke ... (Apiaceae), a winter annual of the North American Eastern Deciduous Forest. ...
| PowerPoint PPT presentation | free to view
Botanic gardens Promoting the use of underutilized plants for improved nutrition and health PowerPoint PPT Presentation
Botanic gardens Promoting the use of underutilized plants for improved nutrition and health - Botanic Gardens Conservation International. Presentation overview ... Asparagus pastorianus - rare. Musa and breadfruit. The conservation imperative ...
Botanic Gardens Conservation International. Presentation overview ... Asparagus pastorianus - rare. Musa and breadfruit. The conservation imperative ...
| PowerPoint PPT presentation | free to view
26 November 2004 PowerPoint PPT Presentation
26 November 2004 - Organizational structures for European collections. On a crop-by-crop basis (centralized) ... Cruciferous crops HRI, UK. Wild brassicas Spain ...
Organizational structures for European collections. On a crop-by-crop basis (centralized) ... Cruciferous crops HRI, UK. Wild brassicas Spain ...
| PowerPoint PPT presentation | free to view
GENBANK, SWISSPROT AND OTHERS PowerPoint PPT Presentation
GENBANK, SWISSPROT AND OTHERS - GENBANK, SWISSPROT AND OTHERS As Problem Sources for CSE 549 Andriy Tovkach Genetics GENBANK OVERVIEW Consists of EMBL, NCBI and DDBJ Started 10 years ago Exponential ...
GENBANK, SWISSPROT AND OTHERS As Problem Sources for CSE 549 Andriy Tovkach Genetics GENBANK OVERVIEW Consists of EMBL, NCBI and DDBJ Started 10 years ago Exponential ...
| PowerPoint PPT presentation | free to download
Identifying genes with high confidence from small samples PowerPoint PPT Presentation
Identifying genes with high confidence from small samples - Allan Tucker, Xiaohui Liu, Eleftherios Panteris, Paul Kellam. Microarray Experiment ... vector of gene-expression levels for one sample. c=0 or 1 ...
Allan Tucker, Xiaohui Liu, Eleftherios Panteris, Paul Kellam. Microarray Experiment ... vector of gene-expression levels for one sample. c=0 or 1 ...
| PowerPoint PPT presentation | free to view


Home About Us Terms and Conditions Privacy Policy Contact Us
Copyright 2024 CrystalGraphics, Inc. — All rights Reserved. PowerShow.com is a trademark of CrystalGraphics, Inc.
genebank — Search results on PowerShow.com