Koonin PowerPoint PPT Presentations

All Time
Show:
Recommended
Sort by:
Steven E. Koonin PowerPoint PPT Presentation
Steven E. Koonin - www-old.me.gatech.edu
www-old.me.gatech.edu
| PowerPoint PPT presentation | free to view
Steven E. Koonin PowerPoint PPT Presentation
Steven E. Koonin - Steven E. Koonin. Chief Scientist, BP plc. Clean Tech Investor Summit, Palm Springs ... Current technology status and plausible technical headroom. Budgets for ...
Steven E. Koonin. Chief Scientist, BP plc. Clean Tech Investor Summit, Palm Springs ... Current technology status and plausible technical headroom. Budgets for ...
| PowerPoint PPT presentation | free to view
Nothing in (computational) biology makes PowerPoint PPT Presentation
Nothing in (computational) biology makes - Title: PowerPoint Presentation Author: Koonin Last modified by: Michael Fetchko Created Date: 11/17/2002 2:33:30 AM Document presentation format: On-screen Show
Title: PowerPoint Presentation Author: Koonin Last modified by: Michael Fetchko Created Date: 11/17/2002 2:33:30 AM Document presentation format: On-screen Show
| PowerPoint PPT presentation | free to view
Evolution of ProteinCoding Genes and the Generalized MistranslationInduced Misfolding Hypothesis' PowerPoint PPT Presentation
Evolution of ProteinCoding Genes and the Generalized MistranslationInduced Misfolding Hypothesis' - the Generalized Mistranslation-Induced Misfolding Hypothesis. ... No mechanistic explanation is suggested, however [Wolf YI, Carmel L, Koonin EV. ...
the Generalized Mistranslation-Induced Misfolding Hypothesis. ... No mechanistic explanation is suggested, however [Wolf YI, Carmel L, Koonin EV. ...
| PowerPoint PPT presentation | free to view
Lattice calculation of thermal properties of lowdensity neutron matter with pionless effective field PowerPoint PPT Presentation
Lattice calculation of thermal properties of lowdensity neutron matter with pionless effective field - H.-M. Mueller, S. E. Koonin, R. Seki, & U. van Kolck, PRC 61, 044320 (2000) D. Lee, B. Borasoy, & T. Schafer, PRC 70, 064002 (2004) ...
H.-M. Mueller, S. E. Koonin, R. Seki, & U. van Kolck, PRC 61, 044320 (2000) D. Lee, B. Borasoy, & T. Schafer, PRC 70, 064002 (2004) ...
| PowerPoint PPT presentation | free to view
Example: Ortholog Prediction PowerPoint PPT Presentation
Example: Ortholog Prediction - the same gene in two species', typically, same function. Paralogs: two genes related by at least one ... Catalase peroxidase in E. coli, yeast, Synechocystis, ...
the same gene in two species', typically, same function. Paralogs: two genes related by at least one ... Catalase peroxidase in E. coli, yeast, Synechocystis, ...
| PowerPoint PPT presentation | free to download
THE SHAPES OF CONDITIONAL EQUILIBRIUM IN THE LIQUID DROP MODEL PowerPoint PPT Presentation
THE SHAPES OF CONDITIONAL EQUILIBRIUM IN THE LIQUID DROP MODEL - Institut for Nuclear Research, Kiev, Ukraine. Shape parameterisations. The variational ... Expansion around sphere in terms of spherical harmonics. Two ...
Institut for Nuclear Research, Kiev, Ukraine. Shape parameterisations. The variational ... Expansion around sphere in terms of spherical harmonics. Two ...
| PowerPoint PPT presentation | free to view
Phraseology PowerPoint PPT Presentation
Phraseology - Phraseology
Phraseology
| PowerPoint PPT presentation | free to download
??????????????, ??? ???????????? ???????? in silico PowerPoint PPT Presentation
??????????????, ??? ???????????? ???????? in silico - ... Phyletic profiles in the Phe/Tyr pathway Arithmetics of phyletic ... Two forms combined aompkzyqvdrlbcefghsnuj-i-- Chorismate ...
... Phyletic profiles in the Phe/Tyr pathway Arithmetics of phyletic ... Two forms combined aompkzyqvdrlbcefghsnuj-i-- Chorismate ...
| PowerPoint PPT presentation | free to download
BoseEinstein correlations in e e collisions at LEP PowerPoint PPT Presentation
BoseEinstein correlations in e e collisions at LEP - Bose-Einstein correlations are a quantum mechanical phenomenon which manifests ... Measured Bose-Einstein Correlations (BECs) are defined as. C(Q)= (Q)/ (Q) Q2 ...
Bose-Einstein correlations are a quantum mechanical phenomenon which manifests ... Measured Bose-Einstein Correlations (BECs) are defined as. C(Q)= (Q)/ (Q) Q2 ...
| PowerPoint PPT presentation | free to view
??????(microbiological ecology): PowerPoint PPT Presentation
??????(microbiological ecology): - Title: Author: chenyc Last modified by: ling lu Created Date: 4/12/2006 11:03:55 AM Document presentation format:
Title: Author: chenyc Last modified by: ling lu Created Date: 4/12/2006 11:03:55 AM Document presentation format:
| PowerPoint PPT presentation | free to view
Molecular Clocks PowerPoint PPT Presentation
Molecular Clocks - Evolution at the molecular level is radically different from evolution at the ... Darwin's theory reinterpreted homology as common ancestry. ATCGGCCACTTTCGCGATCA ...
Evolution at the molecular level is radically different from evolution at the ... Darwin's theory reinterpreted homology as common ancestry. ATCGGCCACTTTCGCGATCA ...
| PowerPoint PPT presentation | free to view
Aucun%20titre%20de%20diapositive PowerPoint PPT Presentation
Aucun%20titre%20de%20diapositive - DAM/SPN, DSM/SPhT and SPhN. Motivations. to get the maximum of physics ... Condensed matter. astrophysics (phenomenological interaction...) Structure (Giant ...
DAM/SPN, DSM/SPhT and SPhN. Motivations. to get the maximum of physics ... Condensed matter. astrophysics (phenomenological interaction...) Structure (Giant ...
| PowerPoint PPT presentation | free to download
Femtoscopy at RHIC : Overview PowerPoint PPT Presentation
Femtoscopy at RHIC : Overview - Transport Models. Little sensitivity to cross-section? June 21, 2005 ... 'Show where models disagree with data too' Feynmann (somewhere) ...
Transport Models. Little sensitivity to cross-section? June 21, 2005 ... 'Show where models disagree with data too' Feynmann (somewhere) ...
| PowerPoint PPT presentation | free to download
The Ising Model PowerPoint PPT Presentation
The Ising Model - ... Soluble and Is a Homework Problem in Graduate-Level Statistical Mechanics. ... What are The Statistical Properties of the Lattice ... Statistical Mechanics ...
... Soluble and Is a Homework Problem in Graduate-Level Statistical Mechanics. ... What are The Statistical Properties of the Lattice ... Statistical Mechanics ...
| PowerPoint PPT presentation | free to view
Are elliptic flow v2 measurements consistent with the formation of the Quark Gluon Plasma at RHIC PowerPoint PPT Presentation
Are elliptic flow v2 measurements consistent with the formation of the Quark Gluon Plasma at RHIC - A de-confined phase leads to an emitting system characterized by a ... convolute source function. with kernel (P. Danielewicz) Measured correlation function ...
A de-confined phase leads to an emitting system characterized by a ... convolute source function. with kernel (P. Danielewicz) Measured correlation function ...
| PowerPoint PPT presentation | free to view
CREATION THEORY and the demonstration of biotic patterns in quantum and cosmological time series PowerPoint PPT Presentation
CREATION THEORY and the demonstration of biotic patterns in quantum and cosmological time series - Title: PowerPoint Presentation Author: Hector Sabelli Last modified by: Hector Sabelli Created Date: 5/5/2005 8:53:25 PM Document presentation format
Title: PowerPoint Presentation Author: Hector Sabelli Last modified by: Hector Sabelli Created Date: 5/5/2005 8:53:25 PM Document presentation format
| PowerPoint PPT presentation | free to view
Unifying measures of gene function and evolution PowerPoint PPT Presentation
Unifying measures of gene function and evolution - ... problems or true biological variation [e.g. fitness effect of gene disruption] ... Build an alignment (MUSCLE); Compute distance matrix (PAML) ...
... problems or true biological variation [e.g. fitness effect of gene disruption] ... Build an alignment (MUSCLE); Compute distance matrix (PAML) ...
| PowerPoint PPT presentation | free to download
Flicker noise PowerPoint PPT Presentation
Flicker noise - Title: . . , . ...
Title: . . , . ...
| PowerPoint PPT presentation | free to download
Michael J. Prather PowerPoint PPT Presentation
Michael J. Prather - Thoughts on Preparing for the IPCC AR5 & other Opportunities Michael J. Prather Earth System Science Dept University of California at Irvine AR5 ARE Extreme Events ...
Thoughts on Preparing for the IPCC AR5 & other Opportunities Michael J. Prather Earth System Science Dept University of California at Irvine AR5 ARE Extreme Events ...
| PowerPoint PPT presentation | free to download
RECONSTRUCTING A PowerPoint PPT Presentation
RECONSTRUCTING A - RECONSTRUCTING A UNIVERSAL TREE All living things share same common ancestor Classical view Prokaryotes Eukaryotes 1977: C. Woese 3 primordial kingdoms ...
RECONSTRUCTING A UNIVERSAL TREE All living things share same common ancestor Classical view Prokaryotes Eukaryotes 1977: C. Woese 3 primordial kingdoms ...
| PowerPoint PPT presentation | free to view
ADSR FFAG Future Plans Roger Barlow PowerPoint PPT Presentation
ADSR FFAG Future Plans Roger Barlow - STFC 'Research and Industry' KTAs EPSRC RS/RC/SK ... Energy Amplifier (Yacine Kadi) Megapie(?) Myrrha(?) KURRI(?) Topics. The Policy Context (Bill) ...
STFC 'Research and Industry' KTAs EPSRC RS/RC/SK ... Energy Amplifier (Yacine Kadi) Megapie(?) Myrrha(?) KURRI(?) Topics. The Policy Context (Bill) ...
| PowerPoint PPT presentation | free to download
Reaction mechanism in neutron-rich nuclei PowerPoint PPT Presentation
Reaction mechanism in neutron-rich nuclei - Yoritaka Iwata1 and Takaharu Otsuka1,2. Reaction mechanism in neutron-rich nuclei. 1Department of Physics, ... Contactable or not. 4 nucleons of projectile ...
Yoritaka Iwata1 and Takaharu Otsuka1,2. Reaction mechanism in neutron-rich nuclei. 1Department of Physics, ... Contactable or not. 4 nucleons of projectile ...
| PowerPoint PPT presentation | free to download
Evolutionary Systems Biology PowerPoint PPT Presentation
Evolutionary Systems Biology - 3 How does gene co-expression network topology relate to sequence evolution? ... a coherent picture of the links between phenotypic and genomic evolution? ...
3 How does gene co-expression network topology relate to sequence evolution? ... a coherent picture of the links between phenotypic and genomic evolution? ...
| PowerPoint PPT presentation | free to view
Comparative genomics and metabolic reconstruction of bacterial genomes PowerPoint PPT Presentation
Comparative genomics and metabolic reconstruction of bacterial genomes - Comparative genomics and metabolic reconstruction of bacterial genomes ... Winkler et al., 2002a ... Winkler et al., 2002b; Mironov et al., 2000 ...
Comparative genomics and metabolic reconstruction of bacterial genomes ... Winkler et al., 2002a ... Winkler et al., 2002b; Mironov et al., 2000 ...
| PowerPoint PPT presentation | free to download
Imaging in Heavy-Ion Collisions PowerPoint PPT Presentation
Imaging in Heavy-Ion Collisions - ... uniquely determined at certain r points (termed collocation points) spaced by: ... To reconstruct the source at these collocation points, choose knots: ...
... uniquely determined at certain r points (termed collocation points) spaced by: ... To reconstruct the source at these collocation points, choose knots: ...
| PowerPoint PPT presentation | free to download
Are elliptic flow v2 measurements consistent with the formation of the Quark Gluon Plasma at RHIC PowerPoint PPT Presentation
Are elliptic flow v2 measurements consistent with the formation of the Quark Gluon Plasma at RHIC - Correlation Functions (with pair-cuts etc. Analysis of ... Pair Fractions. 16. P. Chung, SUNY Stony Brook ... images and moments in Au Au collisions at RHIC ...
Correlation Functions (with pair-cuts etc. Analysis of ... Pair Fractions. 16. P. Chung, SUNY Stony Brook ... images and moments in Au Au collisions at RHIC ...
| PowerPoint PPT presentation | free to download
QUANTUM BIOS PowerPoint PPT Presentation
QUANTUM BIOS - Wootters and Zurek (1979)'s quantitative formulation of wave-particle duality. ... De Broglie's wave and particle duality. Schr dinger equation describes waves ...
Wootters and Zurek (1979)'s quantitative formulation of wave-particle duality. ... De Broglie's wave and particle duality. Schr dinger equation describes waves ...
| PowerPoint PPT presentation | free to view
Electrostatic Screening of Nuclear Reactions in Stellar Plasmas PowerPoint PPT Presentation
Electrostatic Screening of Nuclear Reactions in Stellar Plasmas - Electrostatic Screening of Nuclear Reactions in Stellar Plasmas Erice
Electrostatic Screening of Nuclear Reactions in Stellar Plasmas Erice
| PowerPoint PPT presentation | free to view
Comparative genomics and metabolic reconstruction of bacterial pathogens PowerPoint PPT Presentation
Comparative genomics and metabolic reconstruction of bacterial pathogens - S. suis. Structure of the genome loci. S. pyogenes, S. agalactiae. S. equi. S. pneumoniae TIGR4. S. suis. S. pneumoniae R6. Gene functions ...
S. suis. Structure of the genome loci. S. pyogenes, S. agalactiae. S. equi. S. pneumoniae TIGR4. S. suis. S. pneumoniae R6. Gene functions ...
| PowerPoint PPT presentation | free to download
Why Is Sequence Comparison Useful? PowerPoint PPT Presentation
Why Is Sequence Comparison Useful? - Almost 100 Trillion BLAST comparisons per quarter (10/01) ... Alex Souverov. Lewis Geer. Greg Schuler. Steve Bryant & all my colleagues at NCBI and NIH ...
Almost 100 Trillion BLAST comparisons per quarter (10/01) ... Alex Souverov. Lewis Geer. Greg Schuler. Steve Bryant & all my colleagues at NCBI and NIH ...
| PowerPoint PPT presentation | free to download
Orthology%20Analysis PowerPoint PPT Presentation
Orthology%20Analysis - ... OrthoMCL OrthoMCL (blast) proteomes HOPS Orthostrapper (tree) Pfam RIO (tree) Pfam TOGA/EGO COGs (blast) TIGR gene index COGs / KOGs COGs (blast) ...
... OrthoMCL OrthoMCL (blast) proteomes HOPS Orthostrapper (tree) Pfam RIO (tree) Pfam TOGA/EGO COGs (blast) TIGR gene index COGs / KOGs COGs (blast) ...
| PowerPoint PPT presentation | free to download
Overview of Renewable Energy Sources Ali Shakouri Baskin PowerPoint PPT Presentation
Overview of Renewable Energy Sources Ali Shakouri Baskin - Overview of Renewable Energy Sources Ali Shakouri Baskin School of Engineering University of California Santa Cruz http://quantum.soe.ucsc.edu/ Philips Research Lab ...
Overview of Renewable Energy Sources Ali Shakouri Baskin School of Engineering University of California Santa Cruz http://quantum.soe.ucsc.edu/ Philips Research Lab ...
| PowerPoint PPT presentation | free to view
A Universal Trend of Amino Acid Gain and Loss in Protein Evolution PowerPoint PPT Presentation
A Universal Trend of Amino Acid Gain and Loss in Protein Evolution - A Universal Trend of Amino Acid Gain and Loss in Protein Evolution ... A Universal Trend ? No other more plausible explaination ...
A Universal Trend of Amino Acid Gain and Loss in Protein Evolution ... A Universal Trend ? No other more plausible explaination ...
| PowerPoint PPT presentation | free to view
Understanding the emission duration through femtoscopy and imaging PowerPoint PPT Presentation
Understanding the emission duration through femtoscopy and imaging - UCRL-PRES-214483. Understanding the emission duration through femtoscopy ... Developed on MacOS X, linux, cygwin. Time scale for 1.0 release: end of summerish ...
UCRL-PRES-214483. Understanding the emission duration through femtoscopy ... Developed on MacOS X, linux, cygwin. Time scale for 1.0 release: end of summerish ...
| PowerPoint PPT presentation | free to download
Introduction to phylogenetic/phylogenomic concepts and methods PowerPoint PPT Presentation
Introduction to phylogenetic/phylogenomic concepts and methods - With a brief discussion of phylogenomic methods of species phylogeny estimation and orthology prediction methods
With a brief discussion of phylogenomic methods of species phylogeny estimation and orthology prediction methods
| PowerPoint PPT presentation | free to view
Network topology and evolution of hard to gain and hard to loose attributes PowerPoint PPT Presentation
Network topology and evolution of hard to gain and hard to loose attributes - Network topology and evolution of hard to gain and hard to loose attributes ... Lab members. Raja Jothi. Elena Zotenko. And NCBI journal club discussion group ...
Network topology and evolution of hard to gain and hard to loose attributes ... Lab members. Raja Jothi. Elena Zotenko. And NCBI journal club discussion group ...
| PowerPoint PPT presentation | free to download
Orthology Analysis PowerPoint PPT Presentation
Orthology Analysis - Pairwise orthology confidence by orthostrapping' ... Orthology is not transitive! ... 286356 pairwise orthology assignments ( 75% orthostrap) ...
Pairwise orthology confidence by orthostrapping' ... Orthology is not transitive! ... 286356 pairwise orthology assignments ( 75% orthostrap) ...
| PowerPoint PPT presentation | free to download
IMFIMF Directionnal Correlations PowerPoint PPT Presentation
IMFIMF Directionnal Correlations - A. Le F vre (GSI Darmstadt) WCI III 12-16 February 2005 - Texas A&M ... oblate ... oblate. sphere. beam. transversal. longitudinal ...
A. Le F vre (GSI Darmstadt) WCI III 12-16 February 2005 - Texas A&M ... oblate ... oblate. sphere. beam. transversal. longitudinal ...
| PowerPoint PPT presentation | free to download
Time-Dependent Density Functional Theory (TDDFT) part-2 PowerPoint PPT Presentation
Time-Dependent Density Functional Theory (TDDFT) part-2 - Time-Dependent Density Functional Theory (TDDFT) part-2 Takashi NAKATSUKASA Theoretical Nuclear Physics Laboratory RIKEN Nishina Center Density-Functional Theory (DFT)
Time-Dependent Density Functional Theory (TDDFT) part-2 Takashi NAKATSUKASA Theoretical Nuclear Physics Laboratory RIKEN Nishina Center Density-Functional Theory (DFT)
| PowerPoint PPT presentation | free to view
What is the relative frequency of E etiology in AVH What is the age and sex distribution What is the PowerPoint PPT Presentation
What is the relative frequency of E etiology in AVH What is the age and sex distribution What is the - Panda: Molecular biology of hepatitis E virus ... Generation of Infectious cDNA clone (Panda et al., 2000) ...
Panda: Molecular biology of hepatitis E virus ... Generation of Infectious cDNA clone (Panda et al., 2000) ...
| PowerPoint PPT presentation | free to view
Nothing in computational biology makes PowerPoint PPT Presentation
Nothing in computational biology makes - Only a small fraction of amino acid residues is directly. involved in protein function (including enzymatic) ... T, Weng S, Cherry JM, Botstein D. 1998. ...
Only a small fraction of amino acid residues is directly. involved in protein function (including enzymatic) ... T, Weng S, Cherry JM, Botstein D. 1998. ...
| PowerPoint PPT presentation | free to view
Why Is Sequence Comparison Useful PowerPoint PPT Presentation
Why Is Sequence Comparison Useful - Almost 100 Trillion BLAST comparisons per quarter (10/01) ... Proc Natl Acad Sci U S A 1983 Feb;80(3):726-30 ... In: Ecole de Roscoff 1974, p. 69. Paris:CNRS. ...
Almost 100 Trillion BLAST comparisons per quarter (10/01) ... Proc Natl Acad Sci U S A 1983 Feb;80(3):726-30 ... In: Ecole de Roscoff 1974, p. 69. Paris:CNRS. ...
| PowerPoint PPT presentation | free to view
Computational Analyses of Eukaryotic Gene Evolution PowerPoint PPT Presentation
Computational Analyses of Eukaryotic Gene Evolution - Exon Intron Gene Structure Phenomenon due to exon intron structure Alternative Splicing. ... melanogaster 13451 10305 ... drosophila/ 19967 19931 ...
Exon Intron Gene Structure Phenomenon due to exon intron structure Alternative Splicing. ... melanogaster 13451 10305 ... drosophila/ 19967 19931 ...
| PowerPoint PPT presentation | free to view
Probing twoparticle sources in HIC PowerPoint PPT Presentation
Probing twoparticle sources in HIC - Probing two-particle sources in HIC. Giuseppe Verde, NSCL/Michigan State University ... Find pace-time probes of the reaction:... Taking 'photographs' ...
Probing two-particle sources in HIC. Giuseppe Verde, NSCL/Michigan State University ... Find pace-time probes of the reaction:... Taking 'photographs' ...
| PowerPoint PPT presentation | free to view
????? ??????????? ?????? ? ?????? ??????????????????? PowerPoint PPT Presentation
????? ??????????? ?????? ? ?????? ??????????????????? - ... HxxHxH PHT S. pneumoniae ... (quorum sensing ... Bacillus group Streptococcus group zinT ...
... HxxHxH PHT S. pneumoniae ... (quorum sensing ... Bacillus group Streptococcus group zinT ...
| PowerPoint PPT presentation | free to download
Alternative%20splicing:%20A%20playground%20of%20evolution PowerPoint PPT Presentation
Alternative%20splicing:%20A%20playground%20of%20evolution - Research and Training Center for Bioinformatics ... dipteran insects: Drosophila melanogaster, D. pseudoobscura, Anopheles gambiae ...
Research and Training Center for Bioinformatics ... dipteran insects: Drosophila melanogaster, D. pseudoobscura, Anopheles gambiae ...
| PowerPoint PPT presentation | free to download
Resolving the Evolutionary History of the Fungi PowerPoint PPT Presentation
Resolving the Evolutionary History of the Fungi - Resolving the Evolutionary History of the Fungi
Resolving the Evolutionary History of the Fungi
| PowerPoint PPT presentation | free to view
NPACI AllHands Meeting PowerPoint PPT Presentation
NPACI AllHands Meeting - Dona Crawford (Sandia) Jill Dahlburg (Navy) John Ingram (Schlumberger) ... Carl Kukkonen (ViaSpace) William Lester (UCB) Juan Meza (Sandia) Lori Perine (OSTP, ...
Dona Crawford (Sandia) Jill Dahlburg (Navy) John Ingram (Schlumberger) ... Carl Kukkonen (ViaSpace) William Lester (UCB) Juan Meza (Sandia) Lori Perine (OSTP, ...
| PowerPoint PPT presentation | free to view
Prokaryotic genomesize evolution PowerPoint PPT Presentation
Prokaryotic genomesize evolution - Prokaryotic genome-size evolution. Range of C values in ... a Most probably a paraphyletic group. ... Ergo 308 genes are indispensible. Bacillus subtilis ...
Prokaryotic genome-size evolution. Range of C values in ... a Most probably a paraphyletic group. ... Ergo 308 genes are indispensible. Bacillus subtilis ...
| PowerPoint PPT presentation | free to view
New Prospects for locating the Critical End Point (CEP) in the QCD phase Diagram PowerPoint PPT Presentation
New Prospects for locating the Critical End Point (CEP) in the QCD phase Diagram - New Prospects for locating the Critical End Point (CEP) in the QCD phase Diagram Roy A. Lacey A Remarkable Scaling of the fine structure of Elliptic Flow is observed ...
New Prospects for locating the Critical End Point (CEP) in the QCD phase Diagram Roy A. Lacey A Remarkable Scaling of the fine structure of Elliptic Flow is observed ...
| PowerPoint PPT presentation | free to download
Genome analysis. PowerPoint PPT Presentation
Genome analysis. - Role of 'junk' DNA in a cell. 97. 13.338. 137Mb. D.melanogaster. 934. 410. 224 ... Non-coding regions can be very well conserved between the species and many ...
Role of 'junk' DNA in a cell. 97. 13.338. 137Mb. D.melanogaster. 934. 410. 224 ... Non-coding regions can be very well conserved between the species and many ...
| PowerPoint PPT presentation | free to download
QGP hydro hadronic cascade model: Status report PowerPoint PPT Presentation
QGP hydro hadronic cascade model: Status report - TH, U.Heinz, D.Kharzeev, R.Lacey and Y.Nara, PLB636(2006)299; in ... Adapted from S.J.Sanders (BRAHMS) @ QM2006. Origin of Mass Ordering. Mass ordering behavior ...
TH, U.Heinz, D.Kharzeev, R.Lacey and Y.Nara, PLB636(2006)299; in ... Adapted from S.J.Sanders (BRAHMS) @ QM2006. Origin of Mass Ordering. Mass ordering behavior ...
| PowerPoint PPT presentation | free to view
Time-Dependent Density Functional Theory (TDDFT) part-2 PowerPoint PPT Presentation
Time-Dependent Density Functional Theory (TDDFT) part-2 - Time-Dependent Density Functional Theory (TDDFT) part-2 ... Picture of pygmy dipole resonance. n. p. n. Ground state. Protons. Neutrons. Low-energy resonance ...
Time-Dependent Density Functional Theory (TDDFT) part-2 ... Picture of pygmy dipole resonance. n. p. n. Ground state. Protons. Neutrons. Low-energy resonance ...
| PowerPoint PPT presentation | free to view
Caltech Center for Complex, Networked Systems PowerPoint PPT Presentation
Caltech Center for Complex, Networked Systems - Theme #1: pervasive, ubiquitous, ... Theme #2: post-genomics biology and medicine ... Strong Link between CNS themes and CCNS vision. CNS 'How the ...
Theme #1: pervasive, ubiquitous, ... Theme #2: post-genomics biology and medicine ... Strong Link between CNS themes and CCNS vision. CNS 'How the ...
| PowerPoint PPT presentation | free to view
Gustavo Henrique Goldman, Ph.D. PowerPoint PPT Presentation
Gustavo Henrique Goldman, Ph.D. - 5) O DNA e os cromossomas. 6) A replica o, o reparo e a recombina o do DNA ... themes: astonishing variety in individual particulars; astonishing constancy in ...
5) O DNA e os cromossomas. 6) A replica o, o reparo e a recombina o do DNA ... themes: astonishing variety in individual particulars; astonishing constancy in ...
| PowerPoint PPT presentation | free to view


Home About Us Terms and Conditions Privacy Policy Contact Us
Copyright 2024 CrystalGraphics, Inc. — All rights Reserved. PowerShow.com is a trademark of CrystalGraphics, Inc.
koonin — Search results on PowerShow.com