Jukes PowerPoint PPT Presentations

All Time
Show:
Recommended
Sort by:
The Jukes PowerPoint PPT Presentation
The Jukes - The Jukes Richard Dugdale traced the genealogy of the family back over 200 years and found a history of pauperism, prostitution, exhaustion, disease, fornication ...
The Jukes Richard Dugdale traced the genealogy of the family back over 200 years and found a history of pauperism, prostitution, exhaustion, disease, fornication ...
| PowerPoint PPT presentation | free to download
Events Management Jo Jukes Marketing Events Manager Oxfam New Zealand PowerPoint PPT Presentation
Events Management Jo Jukes Marketing Events Manager Oxfam New Zealand - Oxfam talks about the role of sustainable events in society and the award ... Medals. Take-aways. Measure then reduce. Think about your consumer choices ...
Oxfam talks about the role of sustainable events in society and the award ... Medals. Take-aways. Measure then reduce. Think about your consumer choices ...
| PowerPoint PPT presentation | free to view
Biological and Psychological Theories of Crime PowerPoint PPT Presentation
Biological and Psychological Theories of Crime - Tattooing is more common among criminals. Few criminals have dark ... Richard Dugdale:The Jukes: A Study in Crime Pauperism, & Heredity. Ada Jukes. 280 Paupers ...
Tattooing is more common among criminals. Few criminals have dark ... Richard Dugdale:The Jukes: A Study in Crime Pauperism, & Heredity. Ada Jukes. 280 Paupers ...
| PowerPoint PPT presentation | free to view
something about positive selection on amino acids substitutions PowerPoint PPT Presentation
something about positive selection on amino acids substitutions - ?????????????? ?????????. ?????????? ?????????? (distance-based methods) ... Jukes-Cantor model. Models of nucleotide substitutions. Haubold and Wiehe 2006 ...
?????????????? ?????????. ?????????? ?????????? (distance-based methods) ... Jukes-Cantor model. Models of nucleotide substitutions. Haubold and Wiehe 2006 ...
| PowerPoint PPT presentation | free to download
Multiple Sequence Alignments and Phylogenetic Trees PowerPoint PPT Presentation
Multiple Sequence Alignments and Phylogenetic Trees - When we used Blast to compare sequences 2 questions may ... Jukes and Cantor. Kimura (transition/transversion) 12 parameter model ... Jukes Cantor. 12 parameter ...
When we used Blast to compare sequences 2 questions may ... Jukes and Cantor. Kimura (transition/transversion) 12 parameter model ... Jukes Cantor. 12 parameter ...
| PowerPoint PPT presentation | free to view
Reconstruction of Phylogenetic Trees with Very Short Branches PowerPoint PPT Presentation
Reconstruction of Phylogenetic Trees with Very Short Branches - Simulation of DNA sequence-evolution according to Jukes-Cantor via SeqGen. Input distances calculated via the Jukes-Cantor formula. ...
Simulation of DNA sequence-evolution according to Jukes-Cantor via SeqGen. Input distances calculated via the Jukes-Cantor formula. ...
| PowerPoint PPT presentation | free to view
Phylogenetic Reconstruction Using NeighborJoining PowerPoint PPT Presentation
Phylogenetic Reconstruction Using NeighborJoining - Jukes-Cantor. Notice that Bubalus is the outgroup. Trastrep is nested within the tree ... Analysis 1: ML Consensus Bootstrapped Jukes-Cantor corrected ...
Jukes-Cantor. Notice that Bubalus is the outgroup. Trastrep is nested within the tree ... Analysis 1: ML Consensus Bootstrapped Jukes-Cantor corrected ...
| PowerPoint PPT presentation | free to view
Distance Based Methods for estimating phylogenetic trees PowerPoint PPT Presentation
Distance Based Methods for estimating phylogenetic trees - The Jukes-Cantor model states that all states {A,C,G,T} and all ... Under the Jukes-Cantor model where all point mutations are equally likely the correction is: ...
The Jukes-Cantor model states that all states {A,C,G,T} and all ... Under the Jukes-Cantor model where all point mutations are equally likely the correction is: ...
| PowerPoint PPT presentation | free to view
Sequence Alignment PowerPoint PPT Presentation
Sequence Alignment - Large number of sequences to search your query sequence against. ... Jukes-Cantor model. Transitions vs transversions. Kimura's 2-parameter model ...
Large number of sequences to search your query sequence against. ... Jukes-Cantor model. Transitions vs transversions. Kimura's 2-parameter model ...
| PowerPoint PPT presentation | free to download
Comparison of bacterial community structure and diversity in the rhizophere of three plant species i PowerPoint PPT Presentation
Comparison of bacterial community structure and diversity in the rhizophere of three plant species i - Comparison of bacterial community structure and diversity in the rhizophere of ... a matrix of Jukes-Cantor distances. neighbor-joining method ...
Comparison of bacterial community structure and diversity in the rhizophere of ... a matrix of Jukes-Cantor distances. neighbor-joining method ...
| PowerPoint PPT presentation | free to view
Maximum Likelihood PowerPoint PPT Presentation
Maximum Likelihood - Its slow uptake by the scientific community has to do ... of C is 0.25 (a simplified version of the Jukes and Cantor 1969 model) ... Jukes and Cantor (JC69) ...
Its slow uptake by the scientific community has to do ... of C is 0.25 (a simplified version of the Jukes and Cantor 1969 model) ... Jukes and Cantor (JC69) ...
| PowerPoint PPT presentation | free to view
Phylogenetic Tree Reconstruction PowerPoint PPT Presentation
Phylogenetic Tree Reconstruction - Mutation probabilities: P(a|b, t) Models for evolutionary mutations. Jukes Cantor. Kimura model ... If the probabilistic model is correct, the ML distances ...
Mutation probabilities: P(a|b, t) Models for evolutionary mutations. Jukes Cantor. Kimura model ... If the probabilistic model is correct, the ML distances ...
| PowerPoint PPT presentation | free to view
Margaret Dayhoff PowerPoint PPT Presentation
Margaret Dayhoff - 'To those who would know the biochemical structure, function and ... Uniform mutation rates (Jukes-Cantor) Two separate mutation rates (Kimura) Transitions ...
'To those who would know the biochemical structure, function and ... Uniform mutation rates (Jukes-Cantor) Two separate mutation rates (Kimura) Transitions ...
| PowerPoint PPT presentation | free to view
New Jersey Statewide Systemic Model for Professional Learning and Growth PowerPoint PPT Presentation
New Jersey Statewide Systemic Model for Professional Learning and Growth - New Jersey Statewide Systemic Model for Professional Learning and Growth Students as Digital Learners in 21st Century Learning Environments Ian Jukes
New Jersey Statewide Systemic Model for Professional Learning and Growth Students as Digital Learners in 21st Century Learning Environments Ian Jukes
| PowerPoint PPT presentation | free to view
Phylogeny PowerPoint PPT Presentation
Phylogeny - If two sequences are homologs, they are descended from a most recent common ancestor sequence. ... Jukes-Cantor. Assumes all base frequencies are ...
If two sequences are homologs, they are descended from a most recent common ancestor sequence. ... Jukes-Cantor. Assumes all base frequencies are ...
| PowerPoint PPT presentation | free to view
Markov models PowerPoint PPT Presentation
Markov models - Q-matrix for the Jukes and Cantor (JC) model -3/4m 1/4m 1/4m 1/4m. 1/4m -3/4m 1/4m 1/4m ... Jukes and Cantor (JC) model solution. Pii(t) = 1/4 3/4 exp(-mt) ...
Q-matrix for the Jukes and Cantor (JC) model -3/4m 1/4m 1/4m 1/4m. 1/4m -3/4m 1/4m 1/4m ... Jukes and Cantor (JC) model solution. Pii(t) = 1/4 3/4 exp(-mt) ...
| PowerPoint PPT presentation | free to view
Infrastructure for the European Network for Earth System modelling ISENES PowerPoint PPT Presentation
Infrastructure for the European Network for Earth System modelling ISENES - SA2: Michael Lautenschlager and Martin Jukes. JRA1: Steve Mullerworth and Graham Riley ... JRA4; Martin Juckes and Michael Lautenschlager. JRA5: Laurent Terray ...
SA2: Michael Lautenschlager and Martin Jukes. JRA1: Steve Mullerworth and Graham Riley ... JRA4; Martin Juckes and Michael Lautenschlager. JRA5: Laurent Terray ...
| PowerPoint PPT presentation | free to view
Phylogenetic trees PowerPoint PPT Presentation
Phylogenetic trees - In a 'binary' tree, all nodes have degree 1 or 3, except the ... Evolutionary linguistics. How to estimate distances? T. Jukes and C. Cantor. Berkeley, 1969 ...
In a 'binary' tree, all nodes have degree 1 or 3, except the ... Evolutionary linguistics. How to estimate distances? T. Jukes and C. Cantor. Berkeley, 1969 ...
| PowerPoint PPT presentation | free to view
In the Real World: Creating clientcentred learning experiences for final year public relations stude PowerPoint PPT Presentation
In the Real World: Creating clientcentred learning experiences for final year public relations stude - Employability as critical recruitment factor (Green et al., 2005) ... Preparing students for jobs that do not yet exist (Jukes & McCain, 2001) ...
Employability as critical recruitment factor (Green et al., 2005) ... Preparing students for jobs that do not yet exist (Jukes & McCain, 2001) ...
| PowerPoint PPT presentation | free to view
Introduction to PowerPoint PPT Presentation
Introduction to - Weighted Parsimony and Sankoff's Algorithm. Large Parsimony Problem ... Protein (PAM) and DNA (Jukes-Cantor) distances. Least Squares Methods. UPGMA. Neighbor Joining ...
Weighted Parsimony and Sankoff's Algorithm. Large Parsimony Problem ... Protein (PAM) and DNA (Jukes-Cantor) distances. Least Squares Methods. UPGMA. Neighbor Joining ...
| PowerPoint PPT presentation | free to view
Practical effects and implications of gamma distances, a test case in Metazoan Phylogeny PowerPoint PPT Presentation
Practical effects and implications of gamma distances, a test case in Metazoan Phylogeny - Marcelo Garcia & Claudia A M Russo. Laborat rio Nacional de ... Jukes-Cantor. NJ tree with Tamura-Nei distances for heterogeneous sequences, gamma = 0,5 ...
Marcelo Garcia & Claudia A M Russo. Laborat rio Nacional de ... Jukes-Cantor. NJ tree with Tamura-Nei distances for heterogeneous sequences, gamma = 0,5 ...
| PowerPoint PPT presentation | free to view
Introduction to PowerPoint PPT Presentation
Introduction to - Introduction to Bioinformatics Introduction to Bioinformatics. Neandertal, Germany, 1856 Introduction to Bioinformatics LECTURE 5: INTER- AND INTRASPECIES VARIATION ...
Introduction to Bioinformatics Introduction to Bioinformatics. Neandertal, Germany, 1856 Introduction to Bioinformatics LECTURE 5: INTER- AND INTRASPECIES VARIATION ...
| PowerPoint PPT presentation | free to view
Prezentace aplikace PowerPoint PowerPoint PPT Presentation
Prezentace aplikace PowerPoint - SNPs Single Nucleotide Polymorphism Polymorfimus DNA, kdy se jedinci nebo druhy li v jedn nukleotidov z m n AAGCCTA AAGCTTA V tomto p pad mluv me o ...
SNPs Single Nucleotide Polymorphism Polymorfimus DNA, kdy se jedinci nebo druhy li v jedn nukleotidov z m n AAGCCTA AAGCTTA V tomto p pad mluv me o ...
| PowerPoint PPT presentation | free to view
Genetic Distance PowerPoint PPT Presentation
Genetic Distance - The number of evolutionary events that ... by codon position ... Codon substitution model. Some general points: - genetic distances can be far greater than 1 ...
The number of evolutionary events that ... by codon position ... Codon substitution model. Some general points: - genetic distances can be far greater than 1 ...
| PowerPoint PPT presentation | free to view
A leaf is a complex habitat' Leaves of different plants, and sometimes leaves on different parts of PowerPoint PPT Presentation
A leaf is a complex habitat' Leaves of different plants, and sometimes leaves on different parts of - Leaves of different plants, and sometimes leaves on different parts of the same ... this year, the entire class focused their efforts on the American Trout Lily ...
Leaves of different plants, and sometimes leaves on different parts of the same ... this year, the entire class focused their efforts on the American Trout Lily ...
| PowerPoint PPT presentation | free to view
21st Century Learning Tools for the Classroom PowerPoint PPT Presentation
21st Century Learning Tools for the Classroom - mega- millions 1,000,000. giga- billions 1,000,000,000. tera- trillions 1,000,000,000,000 ... Updated to 100 million Fortune Magazine, 9-4-2006 ...
mega- millions 1,000,000. giga- billions 1,000,000,000. tera- trillions 1,000,000,000,000 ... Updated to 100 million Fortune Magazine, 9-4-2006 ...
| PowerPoint PPT presentation | free to view
Did You Know 4 21st Century Learning Tools for the Classroom Revised 72007 PowerPoint PPT Presentation
Did You Know 4 21st Century Learning Tools for the Classroom Revised 72007 - Millions of amateur reporters now have their own digital printing press. ... serves 100 million videos per day. .served 2.5 billion videos to nearly 20 million ...
Millions of amateur reporters now have their own digital printing press. ... serves 100 million videos per day. .served 2.5 billion videos to nearly 20 million ...
| PowerPoint PPT presentation | free to view
MCALIGN: Stochastic Alignment of Non-coding DNA Sequences based on an Evolutionary Model of Sequence Evolution PowerPoint PPT Presentation
MCALIGN: Stochastic Alignment of Non-coding DNA Sequences based on an Evolutionary Model of Sequence Evolution - MCALIGN: Stochastic Alignment of Non-coding DNA Sequences based on an ... Where indels almost occur in multiples of three bp and rarely cross codon boundaries ...
MCALIGN: Stochastic Alignment of Non-coding DNA Sequences based on an ... Where indels almost occur in multiples of three bp and rarely cross codon boundaries ...
| PowerPoint PPT presentation | free to view
The Role of Design in the First-Year Computer Science Curriculum PowerPoint PPT Presentation
The Role of Design in the First-Year Computer Science Curriculum - The Role of Design in the First-Year Computer ... Design is the set of activities including (1) defining an ... Snapshot of the next two weeks ...
The Role of Design in the First-Year Computer ... Design is the set of activities including (1) defining an ... Snapshot of the next two weeks ...
| PowerPoint PPT presentation | free to view
WELCOME TO THE MIDDLETOWN PUBLIC SCHOOLS PowerPoint PPT Presentation
WELCOME TO THE MIDDLETOWN PUBLIC SCHOOLS - Updated to 100 million Fortune Magazine, 9-4-2006 ... Former Maine Governor Angus King presentation - http://web.mac.com ... Fortune Magazine 8-7-2006 ...
Updated to 100 million Fortune Magazine, 9-4-2006 ... Former Maine Governor Angus King presentation - http://web.mac.com ... Fortune Magazine 8-7-2006 ...
| PowerPoint PPT presentation | free to view
Increase Literacy through Technology PowerPoint PPT Presentation
Increase Literacy through Technology - Increase Literacy through Technology Bridging the Gap Between Students and Teachers
Increase Literacy through Technology Bridging the Gap Between Students and Teachers
| PowerPoint PPT presentation | free to download
Biological PowerPoint PPT Presentation
Biological - Deviance as Pathology *
Deviance as Pathology *
| PowerPoint PPT presentation | free to download
Indicators for Malaria Impact Evaluation PowerPoint PPT Presentation
Indicators for Malaria Impact Evaluation - Indicators for Malaria Impact Evaluation Impact Evaluation Team
Indicators for Malaria Impact Evaluation Impact Evaluation Team
| PowerPoint PPT presentation | free to view
Did You Know III 21st Century Learning Tools for the Classroom Revised 72007 PowerPoint PPT Presentation
Did You Know III 21st Century Learning Tools for the Classroom Revised 72007 - Millions of amateur reporters now have their own digital printing press. ... serves 100 million videos per day. .served 2.5 billion videos to nearly 20 million ...
Millions of amateur reporters now have their own digital printing press. ... serves 100 million videos per day. .served 2.5 billion videos to nearly 20 million ...
| PowerPoint PPT presentation | free to view
An introduction to maximum likelihood PowerPoint PPT Presentation
An introduction to maximum likelihood - Probability of consistency: Parsimony will be consistent if: ... less than 0.5, consistency requires that P2 Q(1-Q) Consistency is not guaranteed ...
Probability of consistency: Parsimony will be consistent if: ... less than 0.5, consistency requires that P2 Q(1-Q) Consistency is not guaranteed ...
| PowerPoint PPT presentation | free to view
Computational methods in phylogenetic analysis PowerPoint PPT Presentation
Computational methods in phylogenetic analysis - Better approximations/lower bounds Relationship between quality of ... Ochman estimated that 755 of 4,288 ORF's in E.coli were from at least 234 LGT events ...
Better approximations/lower bounds Relationship between quality of ... Ochman estimated that 755 of 4,288 ORF's in E.coli were from at least 234 LGT events ...
| PowerPoint PPT presentation | free to download
Evolutionary Change in Nucleotide Sequences PowerPoint PPT Presentation
Evolutionary Change in Nucleotide Sequences - For example, if we start with a sequence made of adenines only, then PA(0) = 1, ... The expected frequency of A in the sequence at equilibrium will be 1/4, and so ...
For example, if we start with a sequence made of adenines only, then PA(0) = 1, ... The expected frequency of A in the sequence at equilibrium will be 1/4, and so ...
| PowerPoint PPT presentation | free to view
Maximum likelihood PowerPoint PPT Presentation
Maximum likelihood - MP is an ML model that makes particular assumptions. The Goldman (1990) model ... The model (assumptions) are explicit. We can statistically compare alternative models ...
MP is an ML model that makes particular assumptions. The Goldman (1990) model ... The model (assumptions) are explicit. We can statistically compare alternative models ...
| PowerPoint PPT presentation | free to view
Phylogenetic study of Aedes albopictus and Aedes koreicus (Diptera, Culicidae) origin, two invasive mosquito species in Belgium PowerPoint PPT Presentation
Phylogenetic study of Aedes albopictus and Aedes koreicus (Diptera, Culicidae) origin, two invasive mosquito species in Belgium - Discovery of these two invasive species suggests a ... Coosemans M, Van Bortel W: Bionomics of the established exotic mosquito species Aedes koreicus in Belgium, Europe.
Discovery of these two invasive species suggests a ... Coosemans M, Van Bortel W: Bionomics of the established exotic mosquito species Aedes koreicus in Belgium, Europe.
| PowerPoint PPT presentation | free to download
Building the Virtual Library PowerPoint PPT Presentation
Building the Virtual Library - ... Iberoamericana, Mexico City. Labette Community College ... Leeds College of Art and Design. Leeds Metropolitan University. Lehigh Carbon Community College ...
... Iberoamericana, Mexico City. Labette Community College ... Leeds College of Art and Design. Leeds Metropolitan University. Lehigh Carbon Community College ...
| PowerPoint PPT presentation | free to view
Molecular Clocks PowerPoint PPT Presentation
Molecular Clocks - Evolution at the molecular level is radically different from evolution at the ... Darwin's theory reinterpreted homology as common ancestry. ATCGGCCACTTTCGCGATCA ...
Evolution at the molecular level is radically different from evolution at the ... Darwin's theory reinterpreted homology as common ancestry. ATCGGCCACTTTCGCGATCA ...
| PowerPoint PPT presentation | free to view
pADIC APPROACH TO THE GENETIC CODE AND THE GENOME PowerPoint PPT Presentation
pADIC APPROACH TO THE GENETIC CODE AND THE GENOME - p-adic codon space: C (cytosine) = 1, A (adenine) = 2, ... Modern assignment of codon doublets to particular amino acids may be a result of ...
p-adic codon space: C (cytosine) = 1, A (adenine) = 2, ... Modern assignment of codon doublets to particular amino acids may be a result of ...
| PowerPoint PPT presentation | free to view
Inf PowerPoint PPT Presentation
Inf - Inf rence phylog n tique Observed sequence alignment (D) phylogenetic tree (T) Chick A E F D L Y K S S E F D L Y K S Human S E F D V Y K S Cat Fish
Inf rence phylog n tique Observed sequence alignment (D) phylogenetic tree (T) Chick A E F D L Y K S S E F D L Y K S Human S E F D V Y K S Cat Fish
| PowerPoint PPT presentation | free to view
Building Phylogenetic Trees PowerPoint PPT Presentation
Building Phylogenetic Trees - 1. Building Phylogenetic Trees. Yaw-Ling Lin (???) ... Chimp. Dog. Elephant. A: CAGGTA. B: CAGACA. C: CGGGTA. D: TGCACT. E: TGCGTA. 52 ...
1. Building Phylogenetic Trees. Yaw-Ling Lin (???) ... Chimp. Dog. Elephant. A: CAGGTA. B: CAGACA. C: CGGGTA. D: TGCACT. E: TGCGTA. 52 ...
| PowerPoint PPT presentation | free to view
Sequence Evolution PowerPoint PPT Presentation
Sequence Evolution
| PowerPoint PPT presentation | free to view
Models of molecular evolution PowerPoint PPT Presentation
Models of molecular evolution - Models of molecular evolution. Steps in evaluating one tree. Pick a set of branch lengths ... Objective criterion for choosing a model of molecular evolution ...
Models of molecular evolution. Steps in evaluating one tree. Pick a set of branch lengths ... Objective criterion for choosing a model of molecular evolution ...
| PowerPoint PPT presentation | free to view
Phylogenetics%20I PowerPoint PPT Presentation
Phylogenetics%20I - White-fronted capuchin. Slow loris. Tree shrew. Japanese pipistrelle. Long-tailed bat ... White-fronted capuchin. Slow loris. Squirrel. Dormouse. Cane-rat ...
White-fronted capuchin. Slow loris. Tree shrew. Japanese pipistrelle. Long-tailed bat ... White-fronted capuchin. Slow loris. Squirrel. Dormouse. Cane-rat ...
| PowerPoint PPT presentation | free to download
Class 9: Phylogenetic Trees PowerPoint PPT Presentation
Class 9: Phylogenetic Trees - Class 9: Phylogenetic Trees The Tree of Life Evolution Many theories of evolution Basic idea: speciation events lead to creation of different species Speciation ...
Class 9: Phylogenetic Trees The Tree of Life Evolution Many theories of evolution Basic idea: speciation events lead to creation of different species Speciation ...
| PowerPoint PPT presentation | free to download
Joel PowerPoint PPT Presentation
Joel - The word Prions (pronounced Pree-Ons) is short for proteinaceous infectious ... and scrapies in animals including kuru and Creutzfeldt-Jakob disease in humans. ...
The word Prions (pronounced Pree-Ons) is short for proteinaceous infectious ... and scrapies in animals including kuru and Creutzfeldt-Jakob disease in humans. ...
| PowerPoint PPT presentation | free to view
Introduction to Computational Biology PowerPoint PPT Presentation
Introduction to Computational Biology - Kimura's two-parameter model. Molecular clock. Relative rate test. Phylogenetics ... Quantile normalization. Quality control. Data distributions. Histograms. boxplots ...
Kimura's two-parameter model. Molecular clock. Relative rate test. Phylogenetics ... Quantile normalization. Quality control. Data distributions. Histograms. boxplots ...
| PowerPoint PPT presentation | free to download
Burning the Bra PowerPoint PPT Presentation
Burning the Bra - MYTH: Many women site the need to wear bras because of a dress code or a desire ... Bras and bra-wearing hails women into the ideology of the feminine and womanhood. ...
MYTH: Many women site the need to wear bras because of a dress code or a desire ... Bras and bra-wearing hails women into the ideology of the feminine and womanhood. ...
| PowerPoint PPT presentation | free to view
Simpleminded molecular homology PowerPoint PPT Presentation
Simpleminded molecular homology - ... molecular ... Molecular homology. Two proteins in two different organisms may be encoded ... is of interest to molecular evolutionary biologists ...
... molecular ... Molecular homology. Two proteins in two different organisms may be encoded ... is of interest to molecular evolutionary biologists ...
| PowerPoint PPT presentation | free to view
ASSISTANT DIRECTOR PowerPoint PPT Presentation
ASSISTANT DIRECTOR - Head of Strategic Commissioning (Older People, Carers, Housing) ... Gemma Counsell (temp) Vacancy. Admin Team Manager. Kerry Sussex. Review and Support Officers ...
Head of Strategic Commissioning (Older People, Carers, Housing) ... Gemma Counsell (temp) Vacancy. Admin Team Manager. Kerry Sussex. Review and Support Officers ...
| PowerPoint PPT presentation | free to view
Phylogeny II : Parsimony, ML, SEMPHY PowerPoint PPT Presentation
Phylogeny II : Parsimony, ML, SEMPHY - M-step: select new topology based on these expected sufficient statistics ... Find: topology T that maximizes. Si,j is a matrix of # of ...
M-step: select new topology based on these expected sufficient statistics ... Find: topology T that maximizes. Si,j is a matrix of # of ...
| PowerPoint PPT presentation | free to download
Algorithms for Ultra-large Multiple Sequence Alignment and Phylogeny Estimation PowerPoint PPT Presentation
Algorithms for Ultra-large Multiple Sequence Alignment and Phylogeny Estimation - Algorithms for Ultra-large Multiple Sequence Alignment and Phylogeny Estimation Tandy Warnow Department of Computer Science The University of Texas at Austin
Algorithms for Ultra-large Multiple Sequence Alignment and Phylogeny Estimation Tandy Warnow Department of Computer Science The University of Texas at Austin
| PowerPoint PPT presentation | free to download


Home About Us Terms and Conditions Privacy Policy Contact Us
Copyright 2025 CrystalGraphics, Inc. — All rights Reserved. PowerShow.com is a trademark of CrystalGraphics, Inc.
jukes — Search results on PowerShow.com