Title: DNA Microarrays for Biomedical Research:
1DNA Microarrays for Biomedical Research Wonders
and Cautions
Daniel R. Salomon, M.D. Department of Molecular
and Experimental Medicine The Scripps Research
Institute
2If you dont understand anything today - it is my
fault. This is just technology.
3300-500,000 Proteins
What is a gene?
30-35,000 Open Reading Frames (ORFs)
Genome Transcriptosome Proteosome
4Environment ECM, Ischemia, Stress Growth
Factors Cytokines Development/Differentiation
Programs
Baseline/Constitutive
Activated
What happens immediately, what happens next?
5Tissues are complex mixtures of different cell
types.
Infiltrating Inflammatory Cells
Endothelium
Epithelium
Mesenchymal Elements
6How are signal pathways regulated by
transcription?
7Gene Discovery vs. Custom Arrays
- Gene Discovery Arrays Affymetrix
GeneChips Incyte - Rosetta
- Filter arrays
- Custom DNA Microarrays Low-cost
Replicate data
points Focused sets of genes
8Affymetrix Chip Technology
9Affymetrix Photolithography-based Gene Chip
Printing
10Affymetrix Chip System
Chip Hybe/Wash Station
Array Scanner
Informatics Work Station
11Processing Microarray Image Data - Step 1
Scanning Image
Red - Cy5 Green - Cy3 Yellow - Both
12Processing Microarray Image Data - Step 2
Creating an image mask
13Processing Microarray Image Data - Step 3
Analyzing probe intensity at a single spot
14Processing Microarray Image Data - Step 4
Comparing multiple time points or conditions
15Image Analysis
- ImaGene (Biodiscovery)
- QuantArray (GSI Lumonics)
- Affymetrix GeneChip software
16Data Analysis
- Excel
- GeneSpring (Silicon Genetics)
- Affymetrix GeneChip software
- Cluster/Treeview (Stanford)
- NFUEGO, Promoter Cruncher, Chip Annotation
databases
17Image files (from Affymetrix or Custom slide
arrays)
To Web
Database
Server
Annotation Database
Promoter Cruncher
User Workstations ImaGene, GeneSpring,
Cluster/Treeview GeneChip, NFUEGO
18(No Transcript)
19(No Transcript)
20Affymetrix Chip HG U95A
21Incyte Genomics Human UniGene I Array (8393
unique genes or ESTs)
Clone ID Accession Gene Name 1362728
AF068236 nitric oxide synthase 2A (inducible,
hepatocytes) 1363074 BF035921 lymphocyte
cytosolic protein 1 (L-plastin) 1363684
NM_014823 KIAA0344 gene product 1363832
NM_006405 transmembrane 9 superfamily member
1 1364004 AA778107 Homo sapiens mRNA cDNA
DKFZp586O2124 1364225 AW136140 Homo sapiens
cDNA FLJ23053 fis, clone LNG02858 1365434
AI627624 zinc finger protein 195 1365507
BE045743 LBP protein 32 1365962 U75898 heat
shock 27kD protein 2 1365975 AA595575 Homo
sapiens cDNA FLJ23516 fis, clone
LNG04848 1366043 BE043061 Homo sapiens cDNA
FLJ12366 fis, clone MAMMA1002411 1366085
NM_001129 AE-binding protein 1 1366602
AI416967 MUM2 protein 1366614 N68666 f-box
and leucine-rich repeat protein 7 1366817
R58925 EST 1366978 AF007170 DEME-6
protein 1367201 AI754198 KIAA0076 gene
product 1367516 AA813998 ESTs 1367527
AF072164 HsHomo sapiens HSFE-1 mRNA, partial
cds 1367862 H39214 ESTs 1368173
Y00698 phosphofructokinase, muscle 1368319
AA348317 ESTs 1368493 AK000005 FLJ00005
protein 1368653 X57548 cadherin 2, type 1,
N-cadherin (neuronal)
22http//www.gene.ucl.ac.uk/cgi-bin/nomenclature/
Human Gene Nomenclature Database Genew3
Search Search of Approved Symbols AND Literature
Aliases from this page help This public copy
of the database was last updated on Wed Apr 11,
2001 Now containing 12892 active gene
symbols and 8700 literature aliases and 2634
withdrawn symbols Quick search by first letter
of symbol help A B C D E F G H I J K L M N O P
Q R S T U V W X Y Z
23Page 1 of 4 Cadherins
Symbol Full Name Cytogenetic Location PubMed
ID CDH1 cadherin 1, type 1, E-cadherin
(epithelial) 16q22.1 9925936 CDH2 cadherin 2,
type 1, N-cadherin (neuronal) 18q12.1 2384753 CD
H3 cadherin 3, type 1, P-cadherin (placental)
16q22.1 1427864 CDH4 cadherin 4, type 1,
R-cadherin (retinal) 20q13.3 10191097 CDH5 cadhe
rin 5, type 2, VE-cadherin reserved 2059658 CD
H6 cadherin 6, type 2, K-cadherin (fetal
kidney) 5p14-p15.1 7743525 CDH7 cadherin 7, type
2 18q22-q23 9615235 CDH8 cadherin 8, type
2 16q22.1 9615235 CDH9 cadherin 9, type 2
(T1-cadherin) reserved 2059658 CDH10 cadherin
10, type 2 (T2-cadherin) 5p13-p14 2059658 CDH11
cadherin 11, type 2, (osteoblast) 16q22.1 96152
35 CDH12 cadherin 12, type 2 (N-cadherin
2) 5p14-p13 7731968 CDH12P cadherin 12
(N-cadherin 2) pseudogene 5q13 7731968 CDH13 cad
herin 13, H-cadherin (heart) 16q24.2 8673923 CD
H15 cadherin 15, M-cadherin (myotubule) 16q24.3
1427864 CDH16 cadherin 16, KSP-cadherin 16q21-q22
9721215 CDH17 cadherin 17, LI cadherin
(liver-intestine) 8q22.2-q22.3 9615235 CDH18 cadh
erin 18, type 2 5p15.1-p15.2 9030594 CDH19 cadh
erin 19, type 2 18q22-q23 CDH20 cadherin 20,
type 2 18q22-q23 CDH21 cadherin
21 reserved CDH23 cadherin related
23 10q21-q22 11090341 CDH24 cadherin-like
24 reserved
24PubMed Reference for Cadherin 2
N-cadherin gene maps to human chromosome 18 and
is not linked to the E-cadherin gene. Walsh FS,
Barton CH, Putt W, Moore SE, Kelsell D, Spurr N,
Goodfellow PN. Department of Experimental
Pathology, UMDS, Guy's Hospital, London,
England. cDNA clones encoding the human
N-cadherin cell adhesion molecule have been
isolated from an embryonic muscle library by
screening with an oligonucleotide probe
complementary to the chick brain sequence and
chick brain cDNA probe lambda N2. Comparison of
the predicted protein sequences revealed greater
than 91 homology between chick brain, mouse
brain, and human muscle N-cadherin cDNAs over
the 748 amino acids of the mature, processed
protein. A single polyadenylation site in the
chick clone was also present and duplicated in
the human muscle sequence. Immediately 3' of the
recognition site in chick a poly(A) tail ensued
however, in human an additional 800 bp of 3'
untranslated sequence followed. Northern analysis
identified a number of major N-cadherin mRNAs.
These were of 5.2, 4.3, and 4.0 kb in C6 glioma,
4.3 and 4.0 kb in human foetal muscle cultures,
and 4.3 kb in human embryonic brain and mouse
brain with minor bands of 5.2 kb in human muscle
and embryonic brain. Southern analysis of a panel
of somatic cell hybrids allowed the human
N-cadherin gene to be mapped to chromosome 18.
This is distinct from the E-cadherin locus on
chromosome 16. Therefore, it is likely that the
cadherins have evolved from a common precursor
gene that has undergone duplication and migration
to other chromosomal locations.
25http//www.gdb.org/
Search by Submit Genomic Segments
Name/GDB ID All Biological Data Keyword People
DNA Sequence ID Citations
Gene List - Accession , Map Coordinates
26Gene Map of Chromosome 8q13.3-8q24.22
Displayed by MapView 2.4
27Custom Microarray Printing
- Glass slide substrate
- 500-10,000 spots/slide
- Robotic spotting device
- cDNA clones
- PCR products
- Oligonucleotides
- (50-70mers)
28The Mguide A complete guide to building your own
microarrayer. http//cmgm.stanford.edu/pbrown/mgui
de
29(No Transcript)
30(No Transcript)
31(No Transcript)
32Oligonucleotides (50-70mers)
- are sequence verified
- eliminate clone library banking
- eliminate PCR and PCR contamination issues
- are inexpensive (500ng of purified 75mer will
print 12,000 arrays each with 3 replicate spots) - can be directed at specific exons to detect
splice variants - can be designed to distinguish closely related
genes
33Array-based genotyping vs.gene expression
analysis
34Solid-phase primer extension assayMini-sequenci
ng, Genetic Bit Analysis (GBA)
1. Hybridization of template DNA to solid-phase
primer
5
XC/T polymorphism
3
Hybridized template
TACGTGACTGATGCTTAGCTTCAATGAGXTGATGTAG
GACTACGAATCGAAGTTACTC
Solid-phase oligonucleotide
Glass slide
353mm
36A Microarray Strategy
Gene Discovery (large arrays, limited numbers of
samples)
Custom DNA microarrays (small arrays, large
numbers of samples)
Genotyping (SNPs)
37The challenges for chip technology I.
- Incredible amounts of data
- An incomplete database
- Technical issues involving multiple
technologies - Relatively primitive tools for handling data
- Major issues for statistical methodologies
- Normalization
- Replicates
- Significant changes
38The challenges for chip technology II.
- Major challenge to scientific thought and
method - Big science or organismal biology
- Hypothesis-driven vs. Fishing Expedition
- How is the transcriptosome regulating the
proteome?
39(No Transcript)
40RNA/Signal Amplification
Clinical Specimens Laser Capture Microscopy