Title: The Genetic Code
1The Genetic Code Transcription
2Overview of the gene expression
Klug, Cummings Spencer, 2006
3The Genetic Code
The general features of the genetic code
4Early studies The triplet nature of the Code
1960s Brenner argued on theoretical grounds
code must be a triplet since three-letter words
represent the minimal use of four letters to
specify 20 amino acids
Experimental work of Crick, Barnett, Brenner
Watts-Tobin proof for the triplet nature of the
code See p 308
5Early studies Nonoverlapping nature of the Code
6Early studies Commaless and degenarate nature
of the Code
7Studies that led to the deciphering of the code
8Decoding the Genetic Code
9Decoding the Genetic Code
10Decoding the Genetic Code
11(No Transcript)
12(No Transcript)
13Different initiation points
GAAAUGUAUGCAUGCCAAAGGAGGCAUCUAAGGA
14(No Transcript)