Gwdg PowerPoint PPT Presentations
All Time
Recommended
... Checkpoint Firewall-I sehr hoher Preis Checkpoint Appliance (NOKIA,SUN) sehr hoher Preis Fortigate (Fortinet) Probleme im Testbetrieb (GWDG ...
| PowerPoint PPT presentation | free to view
WLAN Andreas I leiber andreas.issleiber@gwdg.de
| PowerPoint PPT presentation | free to view
Matrix Transpose Results with Hybrid OpenMP / MPI O. Haan Gesellschaft f r wissenschaftliche Datenverarbeitung G ttingen, Germany ( GWDG ) SCICOMP 2000, SDSC, La Jolla
| PowerPoint PPT presentation | free to download
GWDG. Matrix Transpose Results. with Hybrid OpenMP / MPI. O. Haan ... 8-way Nighthawk - shared memory over all processors. virtual global address space. SP: ...
| PowerPoint PPT presentation | free to view
Title: Kein Folientitel Author: bjohn Last modified by: bjohn Created Date: 10/4/2001 7:30:58 PM Document presentation format: Sondergr e Company
| PowerPoint PPT presentation | free to download
3'052 Nanomechanics of
| PowerPoint PPT presentation | free to download
Martin Banse. Institute of Agricultural Economics, University of G ttingen. 2. Table of Content ... Further information. The paper is available in PDF-Format under ...
| PowerPoint PPT presentation | free to download
Title: PowerPoint-Pr sentation Author: Winfried Kurth Last modified by: wkurth Created Date: 10/23/2006 3:58:10 PM Document presentation format: Bildschirmpr sentation
| PowerPoint PPT presentation | free to download
asdfasdf Asdfasdfasd Asdfasdf asdfasdf place for: i.e. grants & partners (logos), acknoledgement, contact, hompages . It is up to you . Title: Folie 1 Author: Per
| PowerPoint PPT presentation | free to download
Title: PowerPoint-Pr sentation Author: Compaq Armada 3500 Last modified by: Compaq Armada 3500 Created Date: 7/14/2001 5:55:41 PM Document presentation format
| PowerPoint PPT presentation | free to download
Won the Nobel Prize for Literature in 1991. Her mother was British and her father was Jewish ... For Nadine Gordimer, the Nobel Prize winning South African author, the ...
| PowerPoint PPT presentation | free to view
PIDs in Data Infrastructures Peter Wittenburg CLARIN Research Infrastructure EUDAT Data Infrastructure Automatic Workflows most data is created automatically as part ...
| PowerPoint PPT presentation | free to download
Title: Folie 1 Author: opanfyo Last modified by: opanfyo Created Date: 4/26/2005 10:33:58 AM Document presentation format: Bildschirmpr sentation Company
| PowerPoint PPT presentation | free to download
Algae its role, species and production requirements Role of algae in aquaculture First link in the chain of live food manufacture and nutrition.
| PowerPoint PPT presentation | free to download
... (SECCHI, John Cook; commercially available) ... Automated detection of CMEs (David Berghmans) ... (Reiser, Cook, Newmark, Crane, Yahil, Gosnell, Puetter) ...
| PowerPoint PPT presentation | free to download
Aptamers have been selected which bind nucleic acid, proteins, small organic compounds. These novel molecules have many potential uses in medicine and technology ...
| PowerPoint PPT presentation | free to view
Title: No Slide Title Author: hosom Last modified by: h Created Date: 12/24/1999 12:49:58 AM Document presentation format: On-screen Show Other titles
| PowerPoint PPT presentation | free to view
Treat telescopes and databases in a similar manner, both being made ... Searching for extra-Solar planets using gravitational microlensing in the galactic bulge ...
| PowerPoint PPT presentation | free to download
Lectures on Medical Biophysics Department of Biophysics, Medical Faculty, Masaryk University in Brno *
| PowerPoint PPT presentation | free to download
Title: Metal Ions in Biological Systems Author: jirka Last modified by: JIRKA KOZELKA Created Date: 10/31/2005 4:21:31 PM Document presentation format
| PowerPoint PPT presentation | free to download
Title: PowerPoint-Pr sentation Author: TOREROS. Werbeagentur Last modified by: HIWI1 Created Date: 11/27/2002 11:58:25 AM Document presentation format
| PowerPoint PPT presentation | free to view
... maintenance of traditional collections and preservation of ... The Pyramid of Publication. scientific articles. from the University. 13.10.2003. 16. Outline ...
| PowerPoint PPT presentation | free to download
Devices for measurement of Osmolar concentration (measurement is based on cryoscopy), Diffusion Viscosity (practical exercises) ... mentioned in lecture about MRI) ...
| PowerPoint PPT presentation | free to view
Interaction Potential Between a Sphere and a Flat Surface. z=2R. planar. surface. sphere ... volume=px2dz # of atoms=rpx2dz= rp(2R-z)zdz. WSPHERE-SFC(D) ...
| PowerPoint PPT presentation | free to download
Title: P edn ky z l ka sk biofyziky Masarykova univerzita v Brn Author: doc. Mornstein Last modified by: otec Created Date: 9/11/2002 6:40:40 AM
| PowerPoint PPT presentation | free to download
Building a teaching course around crystallographic freeware Lachlan M. D. Cranswick - CCP14 Project, UK and Geochemistry - Lamont-Doherty Earth Observatory of
| PowerPoint PPT presentation | free to view
Title: Kein Folientitel Author: Frank L tzenkirchen Last modified by: neuroth Created Date: 12/1/1999 1:03:14 PM Document presentation format: Bildschirmpr sentation
| PowerPoint PPT presentation | free to download
Title: Bandbreitenkontrolle auf Cisco-Routern/Switches Author: Bodo Gelbe Last modified by: A.Issleiber Created Date: 10/1/1998 9:34:56 PM Document presentation format
| PowerPoint PPT presentation | free to view
Crystal Structure Determination and Refinement Using the Bruker AXS SMART APEX II System
| PowerPoint PPT presentation | free to view
Anwendungen Rechnernetze Thema: LAN Virtualisierung mit 802.1q VLAN Tagging Steffen D hler Hochschule Merseburg Fachbereich Ingenieur- und Naturwissenschaften
| PowerPoint PPT presentation | free to download
5.2.1.1 John Updike, In the Beauty of the Lilies: Clarence. 5.2.1.2 Rickie Moore ... John Van Seters. 5.2 Critical Methodologies. 5.2.4 Literary Criticism: ...
| PowerPoint PPT presentation | free to view
Hawkesworth C.J., O'Nions R.K., Pankhurst R.J., Hamilton P.J., Evensen N.M. (1977) A geochemical study of island-arc and back-arc tholeiites from the Scotia sea.
| PowerPoint PPT presentation | free to download
So how are the lipids and proteins involved in membrane ... for hydrophobicity etc. for motions and vibrations. for van der Walls forces. MEMBRANES more ...
| PowerPoint PPT presentation | free to view
... Metric Constraints X-Ray Diffraction Pattern from Single Crystal X-Ray Diffraction Bragg s law Reflection Indices Diffraction Patterns Reciprocal space ...
| PowerPoint PPT presentation | free to view
Sequence alignment in molecular data analysis: (M. Brudno) ... local alignment (Smith and Waterman, 1983) atctaatagttaatactcgtccaagtat ...
| PowerPoint PPT presentation | free to download
Formation & Evolution of Planets. Sun / Dynamo-driven ... schools in the Ruhr Valley as well as in Lower Saxony. Summer 2002. The Basic Idea of the Project ...
| PowerPoint PPT presentation | free to view
Crystal Structure Determination and Refinement Using the Bruker AXS SMART APEX II System
| PowerPoint PPT presentation | free to view
... http://www.biografien-im-netz.de/ Allgemeine / Neue Deutsche Biographie - http://mdz2.bib-bvb.de/ndb/ndbindex.htm/ DMV - Deutsche Mathematiker-Vereinigung ...
| PowerPoint PPT presentation | free to download
Industrial: manufacturers of automobiles, machinery, chemicals, beverages. Utilities: electrical power companies, gas suppliers, water industry ...
| PowerPoint PPT presentation | free to view
... 5 crypto algorithms: Blowfish, Gost, Vernam, Cast256, and ... Uses blowfish to generate a stream of pseudo-random control bits to define bit encodings ...
| PowerPoint PPT presentation | free to view
Principles of Finance 1st CHAPTER Definition and Basic concepts Definition of Finance: Finance is the art and science of managing money which is concerned with the ...
| PowerPoint PPT presentation | free to view
Title: PowerPoint-Pr sentation Author: Winfried Kurth Last modified by: wkurth Created Date: 10/23/2006 3:58:10 PM Document presentation format: Bildschirmpr sentation
| PowerPoint PPT presentation | free to download
Title: PowerPoint-Pr sentation Author: Oliver.Himmler Last modified by: Oliver.Himmler Created Date: 10/19/2005 9:33:11 PM Document presentation format
| PowerPoint PPT presentation | free to download
Signal Transduction My favorite example Vibrio fischeri The light organ of the squid contains Vibrio fischeri, which under high cell densities emits luminescence.
| PowerPoint PPT presentation | free to download
Spatio-temporal distribution and genetic characterization of some marine macroalgae of the Republic of Mauritius. MPhil/PhD Research By Mrs Persand Jayshree
| PowerPoint PPT presentation | free to view
alain.no l@hec.ca. Facult des sciences conomiques et de gestion ... chantier maritime de Pha Rung (forme de partenariat, apport de chacune des ...
| PowerPoint PPT presentation | free to view
The benefit of plant models for laser generated data - advantages of a symbiosis - Dipl. Inf. Stefan Paulus Institute of Geodesy und Geoinformation
| PowerPoint PPT presentation | free to download
Reverse Transkription 5 3 t-RNA Primer R U5 PBS Virale RNA R U5 R U5 R U3 R U5 U3 PBS U5 PBS R U3 U5 PBS R U3 U5 PBS U3 LTR LTR R U5 R U3 PBS 5 3 Virale RNA ...
| PowerPoint PPT presentation | free to download
Graph-oriented modelling of multiscaled dynamical systems with a dynamical structure: Challenges to the
| PowerPoint PPT presentation | free to download
Title: PowerPoint-Pr sentation Author: Colourman Last modified by: SUB99999 Created Date: 3/28/2001 5:59:54 PM Document presentation format: Bildschirmpr sentation
| PowerPoint PPT presentation | free to download
Agents, Hierarchies and Sustainability Vortrag von und mit Andr Preu ner Nach dem gleichnamigen Paper von Andreas K nig, Michael M hring und Klaus G. Troitzsch
| PowerPoint PPT presentation | free to download
Is researcher in the ... Is active in the research area of test automation, model-based testing, and ... Gau , Weber, Hilbert, ... Center for Informatics ...
| PowerPoint PPT presentation | free to download
Tree of Life. Microbe(s) of the Day: Deep-branching thermophiles. Aquificales and Thermotogales ... Tree of Life. Microbe(s) of the Day: Cyanobacteria ...
| PowerPoint PPT presentation | free to view
| PowerPoint PPT presentation | free to download
Modelling above- and below-ground competition together Winfried Kurth University of G ttingen Chair for Computer Graphics and Ecological Informatics
| PowerPoint PPT presentation | free to download
Title: PowerPoint-Pr sentation Author: Winfried Kurth Last modified by: wkurth Created Date: 10/23/2006 3:58:10 PM Document presentation format: Bildschirmpr sentation
| PowerPoint PPT presentation | free to download
