Title: Palindromes
1Palindromes
2Palindromes - words or phrases that can be read
the same forwards or backwards.
Oh, no, Don Ho
3- Pupils slip up
- Rats live on no evil star
- Do Geese see God?
- Flee to me, remote elf
- Dennis and Edna sinned
- Go deliver a dare, vile dog
- Wonton? Not now.
4- A man, a plan, a cat, a canal Panama
- A dog, a plan, a canal Pagoda
- A man, a plan, a cat, a ham, a yak, a yam, a hat,
a canal Panama
5- Never odd or even
- Tips spill, lips spit
- Devil never even lived
- Go hang a Salami, Im a lasagna hog
- So many dynamos
- Sit on a potato pan, Otis
- Mr. Owl ate my metal worm
- So, Ida, adios!
6Palindromes In Molecular Biology a DNA sequence
can be read the same in the 5 -gt 3 direction on
COMPLEMENTARY strands
5GCAATTGC3 3CGTTAACG5
7How do you know if a sequence is a palindrome?
NO
ATAT ?
yes
Make a sequence that is palidromic
C
G
A
T
T
A
8Any 6 base sequence will occur once in every 46
bases of a genome. These sites exist randomly.
46 4096
A bacterial genome is 106 bases. A six-base
sequence will occur how many times?
10 6 / 4096 244 times
9Can you find the six-base palindromic sequence in
this DNA fragment?
5TATACGGTACCGATCGACAGTTGGTGCCGTTAATT3
5TATACGGTACCGATCGACAGTTGGTGCCGTTAATT3 3ATATGCCA
TGGCTAGCTGTGAACCACGGCAATTAA5
10Genetic Engineering involves Transferring DNA
from one organism to another.
Recombinant DNA is a piece of DNA that is
combined from 2 or more different organisms.
Example a plasmid. PLASMID - a circular piece
of DNA found in bacteria that is used as a
vehicle (vector) for transferring genes from one
organism to another.
Example Agrobacterium transfers a plasmid to
plants. Humans have engineered this plasmid to
contain Bt toxin so the plant can fight insects.
11A Transgenic organism is one that has received
foreign DNA (usually a plasmid).
How do we do this?
12We can Cut DNA using Restriction Endonucleases
(Restriction Enzymes)
Restriction enzymes cut at specific recognition
sites
These sites are palindromic sequences!
13How do Restriction Enzymes cut?
There are 4-base cutters, 6-base cutters, 8-base
cutters, and others.
14DNA from one organism can be cut so it has sticky
ends DNA from another organism can be cut so it
has THE SAME sticky ends The sticky ends can be
pasted back together because of base
complementarity
15(No Transcript)
16(No Transcript)
17Naming Restriction Enzymes
Hundreds of restriction enzymes have been
isolated from bacteria each with its own
specific recognition sequence (these enzymes
serve as a crude immune system for bacteria)
HinDIII H from the genus Haemophilus in
from the species influenzae D from strain D of
this species III the 3rd enzyme from this
organism that was isolated
BamHI B from the genus Bacillus am from the
species amyloliquefaciens H from strain H of
this species I the first enzyme from this
organism that was isolated
18EcoR1 (rasmol image)
Click here and open the rasmol folder Teachers
shared-gt Science -gt Biotech -gt Rasmol
folder Select EcoR1