Title: Primer Design
1Primer Design
- Dave Palmer
- dpalmer_at_zdap.com
2Why Are Primers Important?
- Primers are what gives PCR its SPECIFICITY!!!
- Good primer design PCR works great.
- Bad primer design PCR works terrible.
3Very-Brief PCR Reminder
- PCR is a method to amplify large quantities of a
DNA covering a specific sequence.
4Factors That Affect Priming
- Melting / Annealing Temperature
- Of primers to target
- Secondary Structure
- Within target
- Complementarity
- Primers to target
- Primers to each other
5Factor 1Melting / Annealing Temperature
aagtcagtcagtactagtgatgta aagtcagtcag
- PRIMER LENGTH
- Longer primers stick better melt at a higher
temperature. - GC CONTENT
- More G-C content more triple bonds primers
stick better melt at higher temperature. - PCR Annealing Temp Melt T - 5C
- Tm 4(G C) 2(A T) C
- Tm 58.3C 0.41C (G-C) - 500/length
http//www.alkami.com/primers/refprmr.htm
6Factor 2Secondary Structure
- Primers will have difficulty annealing
- if they anneal to regions of secondary structure
within the target that have a higher melting
point than the primer.
http//www.alkami.com/primers/refprmr.htm
7Factor 3Complementarity
- PRIMER-PRIMER (BAD)
- Excessive similarity between primers, especially
at the 3 ends, leads to the formation of primer
dimers - PRIMER-TARGET (GOOD)
- Ideally should be 100 similar for maximal
specificity. - Primers dont HAVE to be perfectly similar to
target to work.
atcggactatcga gctatacttatggcca
atcggactatcga tagcctgatagctatacttatggcca
http//www.alkami.com/primers/refprmr.htm
8What is a Primer-Dimer
- An unwanted extension product
- Results from primers annealing to themselves, or
each other, at 3 ends - Extended primers are no longer available to prime
target for PCR
atcggactatcga gctatacttatggcca
atcggactatcgatatgaataccgga tagcctgatagctatacttatgg
cca
9Two Strategies for Primer Design
- Pick a primer pair and optimize PCR conditions
for it. - If an exact sequence site needs to be primed or
amplified. - If youre working with someone elses primers.
- Optimize the primer design to work in a specific
set of PCR conditions. - If youve got flexibility around the amplified
site. - Allows more standardized PCR conditions.
?
10Strategy 1 for Primer Design Fixed Primers, Vary
Conditions
- With a given primer pair, the Tm can be
calculated. - Run multiple PCR reactions, each using a
different annealing temperature ( Tm - 5). - Bracket Ta 10C, -5C, 0C, 5C, 10C
- Temp too low Smearing due to non-specific
priming - Temp too high No amplification due to no
priming - Choose conditions which give the best results.
http//www.iscpubs.com/pubs/abl/articles/b9812/b98
12pre.pdf
11Strategy 2 for Primer DesignOptimizing Primers
for Set Conditions
- PCR conditions (esp. annealing temp) are kept
constant. - Select primers for a theoretical Tm.
- Best to select multiple primers, then experiment
to see which combination works best.
F1 atcgatcgatcgatcagtcatcg F2
gtactgagctagctgcagctc R1 atgactgagctgctagcttg R2
atgcatgctcgtgactgtg
F2 F2 R1 F1/R1 F2/R1 R2
F1/R2 F2/R2
95C 65C 72C
12Designing Primers
- Primer Design on the Web
- Example Primer3
- Example gene GFP5 Green Fluorescent Protein
- GFP5, Genebank 1848286
http//frodo.wi.mit.edu/
301 aggagaggac catcttcttc aaggacgacg ggaactacaa
gacacgtgct gaagtcaagt 361 ttgagggaga caccctcgtc
aacaggatcg agcttaaggg aatcgatttc 1 ggatccaagg
agatataaca atgagtaaag gagaagaact tttcactgga
gttgtcccaa 61 ttcttgttga attagatggt gatgttaatg
ggcacaaatt ttctgtcagt ggagagggtg 121 aaggtgatgc
aacatacgga aaacttaccc ttaaatttat ttgcactact
ggaaaactac 181 ctgttccatg gccaacactt gtcactactt
tctcttatgg tgttcaatgc ttttcaagat 241 acccagatca
tatgaagcgg cacgacttct tcaagagcgc catgcctgag
ggatacgtgc aaggaggacg 421 gaaacatcct cggccacaag
ttggaataca actacaactc ccacaacgta tacatcatgg 481
ccgacaagca aaagaacggc atcaaagcca acttcaagac
ccgccacaac atcgaagacg 541 gcggcgtgca actcgctgat
cattatcaac aaaatactcc aattggcgat ggccctgtcc 601
ttttaccaga caaccattac ctgtccacac aatctgccct
ttcgaaagat cccaacgaaa 661 agagagacca catggtcctt
cttgagtttg taacagctgc tgggattaca catggcatgg 721
atgaactata caaataagag ctc
13Designing Primers
- Primer Design on the Web Using Primer3
Enter sequence
Pick Primers
14Designing Primers
- Primer3 Advanced Controls
Primer Size
Primer Tm
Complementarity
15Designing Primers
- Details
- Start
- Length
- Tm
- GC
- Sequence
Where they bind
16Designing Primers
- Primer 3 Output, continued
17Primer Evaluation
- Lets assume we selected the first primer pair
(for rev) - Website for online primer evaluation
TCATTGTTTGCCTCCCTGC TAGAAACCCCAACCCGTGAAA
Enter Sequence
18Primer Evaluation
- Website displays potential problems with primer
self-annealing - More advanced software can examine interactions
between primers
TCATTGTTTGCCTCCCTGC TAGAAACCCCAACCCGTGAAA
Graphical Output
19Primer Evaluation
- Just for fun, lets assume we selected a really
BAD primer...
GGGCCCCTCACCAACCCGTGCCCGGG
20Live Example Primer Design
Primer Design Workflow 1. Pick a gene. ie.
BRCA1 2. Pull up sequence for the gene. a.
http//www.ncbi.nlm.nih.gov/ b. search
Nucleotide Database for brca1 c. scroll through
accessions for desired one 3. Copy sequence to
text editor. 4. Pull up a primer design
website. a. http//frodo.wi.mit.edu/ b. copy
sequence c. select options and choose Pick
Primers 4b. Verify primers find target
(optional) a. http//www.ncbi.nlm.nih.gov/BLAST/
b. select nucleotide blast c. enter primer
sequence, choose blast 4c. Analyse and
double-check the primers a. http//www.idtdna.co
m/analyzer/Applications/OligoAnalyzer/Default.aspx
b. enter sequence, view 5. Order oligos. a.
http//www.operon.com
21End of Primer Design