Cancer Cell Signalling

1
Cancer Cell Signalling

• 20 April 2009
• Dick Brennan
• Department of Biochemistry and Molecular Biology
• S7.8336C
• rgbrenna_at_mdanderson.org

2
Understanding p53 at the structural level
3
Selected References

• Introduction to Protein Structure, Chapters 7
  9. Branden Tooze, Garland Publishing, 2nd
  edition.
• Cho, Y. et al., Crystal Structure of a p53 Tumor
  Suppressor-DNA Complex Understanding Tumorigenic
  Mutations. Science 265346-355, 1994.
• Ho., W.C. et al., Structure of the p53 Core
  Domain Dimer Bound to DNA. J. Biol. Chem.
  28120494-20502, 2006.
• Kitayner, M. et al., Structural Basis of DNA
  Recognition by p53 Tetramers. Mol. Cell
  22741-753, 2006.
• Kwon, E. et al., Crystal Structure of the Mouse
  p53 Core Domain in Zinc-free State. Proteins
  70280-283, 2008.
• Jeffrey, P.D. et al., Crystal Structure of the
  Tetramerization Domain of the p53 Tumor
  Suppressor at 1.7 Angstrom. Science
  2671498-1502, 1995.
• Tidow, H., et al., Quaternary Structures of Tumor
  Suppressor p53 and a Specific p53-DNA Complex.
  Proc. Natl. Acad. Sci., USA 10412324-12329,
  2007.
• Kussie, P.H., et al., Structure of the MDM2
  Oncoprotein Bound to the p53 Tumor Suppressor
  Transactivation Domain. Science 274948-953,
  1996.
• Popowicz, G.M. et al., Molecular Basis for the
  Inhibition of p53 by Mdmx. Cell Cycle
  62386-2392, 2007.

4
Some very informative web sites

• http//www.expasy.org/cgi-bin/niceprot.pl?P04637
• http//p53.bii.a-star.edu.sg/index.php

5
Why is knowing the structure of any protein or
protein-ligand complex so important?
or Why do structural biologists have jobs?
6
The answers, or at least some

• Knowledge of the structure of a protein or a
  protein-ligand complex enriches our understanding
  of the biochemical and biological/physiological
  function of that protein.
• (Chemistry ? Structure) ? Function
• Knowledge of the structure of a protein at the
  atomic level, enables the testing of the roles of
  specific residues in function.
• Knowledge of the structure allows the functional
  interpretation of mutations and hence can provide
  an atomic level understanding of disease.
• Knowledge of the structure of a protein aids in
  the design of novel inhibitors and drugs.

7
Lecture Outline

• Introduction to DNA structure
• Sequence specific recognition by proteins
• p53 structures
• p53 core-DNA complex
• oxidized and demetallated p53
• p53 tetramerization domain
• p53 core tetramer-DNA complexes
• mutations that affect function or stability
• p53-MDM2 complex structure

8
B and A-DNA Structures

• B-DNA, right handed helix, 10.0 base pairs per
  turn, helical twist angle of 35.9, 3.36 Å rise
  per nucleotide
• A-DNA, right handed helix, 10.9 base pairs per
  turn, helical twist angle of 33.1, 2.9 Å rise
  per nucleotide
• But there is a great deal of variability in these
  values!

9
Right Handedness
Two helical forms of DNA each containing 22 base
pairs. (a) B-DNA. (b) A-DNA.
Schematic drawing B-DNA.
10
The Major and Minor Grooves of B-DNA and A-DNA
differ
(5.7 Å)
(11.7 Å)
In B-DNA the major and minor grooves about the
same depth.
In A-DNA the major groove is very deep
whilst minor groove is shallow.
11
Why are there major and minor grooves?
12
Principals of specific base pair recognition of
B-DNA by a protein
W Wide or Major groove S Small or
Minor groove
13
In theory recognition at least of the major
groove should be simple.
All you have to do is match hydrogen bond donors
with hydrogen bond acceptors hydrogen bond
acceptors with hydrogen bond donors and nonpolar
groups with nonpolar groups. Two hydrogen bonds
per base allow complete specificity.
14
Schematic examples of sequence-specific
recognition in the major groove
Each restriction site has its own unique pattern
of hydrogen bond donors and acceptors,nonpolar
groups and hydrogens.
15
Example of sequence specific readout
Glutamine reading an A-T base pair
16
Example of sequence specific readout
Arginine reading a C-G base pair.
17
Specific DNA Recognition

• Direct protein-DNA interaction
• Water-mediated
• Indirect, i.e., the DNA sequence dictates a
  specific structure, which is recognized by the
  protein

18
Understanding p53 at the structural level
19
p53, the guardian of the genome

• Tumor suppressor
• Regulates transcription of genes involved in cell
  cycle arrest (G0 - G1), apoptosis or senescence
• Human p53 is composed of 393 amino acid residues
• DNA binding protein, e.g., p21 and gadd45
  promoters, and a transcription activator
• p53 is a zinc binding protein
• p53 is a homotetramer

20
p53 domain structure


21
p53-protein interactions and post translational
modifications
22
p53 domains and mutational hot spots
Boxes with roman numerals indicate five regions
of the gene conserved across species. Bar graph
shows the position and frequency of tumor-derived
mutations.
23
Crystal structure of the p53 core bound to a
consensus DNA sequence

• Human p53 core encompasses residues 94-312 (in
  the crystal structure only saw 102-292), which
  comprise the entire DNA binding domain
• DNA sequence used in structural study
• ATAATTGGGCAAGTCTAGGAA
• (consensus binding site in bold)

24
The DNA-binding domain of p53 is an antiparallel
? barrel with long loop regions
Ribbon diagram of p53 core. There are 9
antiparallel ? strands (arrows) that form a ?
barrel. Loop regions are colored L1 (green),
L2 (blue) and L3 (red). The C-terminus of the
core is colored purple (? helices in L2
and C-terminus are shown as coils) The
conformations of L2 and L3 are stabilized by a
zinc atom.
25
The DNA-binding domain of p53 is an antiparallel
? barrel
Topology diagram on right shows the 9
antiparallel ? stands. Residues 264-286 form the
critical strand-loop-helix (SLH) also called the
sheet-loop-helix motif of p53.
26
The DNA-binding domain of p53 is an antiparallel
? barrel and takes the same fold as
immunoglobulins.
Most DNA binding proteins utilize a few standard
motifs, e.g., Zn2-fingers and helix-turn-helix
motifs. p53 is unusual but not unique as NF-?B
also takes a similar antiparallel ? barrel fold
also known as the REL homology region.
27
Two loop regions (L1 and L3) and one ? helix (H2)
of p53 bind DNA
Residues R280 (SLH) and K120 (L1) form specific
base contacts in the major groove. Residue R248
(L3) binds in the minor groove. DNA is B-like
but minor groove is compressed around R248.
28
p53-DNA contacts R248 (L3)-minor groove
interactions
R248 is frequently mutated in tumors. The side
chain of R248 is wedged into the minor groove and
makes contacts with the sugar phosphate backbone
of nucleotides T12' and T14. Phosphate
backbone-protein interactions provide binding
affinity. Note the presence of the water
molecule, which mediates protein-base
interaction between the N2 group of G13 and
guanidinium NH of Arg248.
29
Specific p53-DNA major groove contacts R280 (?
Helix, H2) K120 (L1)
R280 is reading the G-C base pair by engaging in
hydrogen bonds with the O6 and N7 atoms of the
guanine base. K120 is reading the G-C base pair
by engaging in hydrogen bonds with the O6 and N7
atoms of the guanine base. K120 also makes a
contact to the O6 of another G.
30
p53-DNA major groove contacts C277 (the loop of
the SLH motif) and S121 (L1)
C277 is making a hydrogen bond from its side
chain ?-SH to the exocyclic N4 of the
cytosine. S121 contacts a nearby adenine ring
through a side chain ?-OH-H2O-N7(Ade) hydrogen
bond network.
31
Buttressing Contacts R273 (SLH)-D281(SLH)-R280
(? Helix)
R273 makes a phosphate backbone contact but also
interacts with D281, which in turn contacts R280
enabling this residue to read base the guanine
base.
32
Residues R175, C176, H179, C238 and C242 are
needed for proper p53 function
C176, H179, C238 and C242 coordinate a structural
zinc atom. This tethers L2 and L3 and stabilises
the loop structure. Residue R175 also aids by
interacting with residue 237 (CO) and the ?OH
of residue S183 (L2). Why are these important?
33
The structural/chemical reasons why the loss of
Zn2 and oxidation are bad.
a. Zn2-free p53. Note the disulphide bond
between C173 and C239 b. Overlay
of p53-(Zn2-DNA), p53-Zn2, and p53-Zn2 free
structures (all murine p53) c. d. L2, L3
and R245 are repositioned. This leads to loss of
R245/R248-minor groove interactions.
34
Structural consequences of the six most
frequently mutated residues of p53 in tumor cell
DNA binding º Zn2 binding Five of the
six are arginine residues. R175 (L2, 6.1), R248
(L3, 9.6) and R273 (LSH, 8.8) are the most
frequently found mutations. Why would their
mutation be bad? The other is a glycine. Why
would its mutation be bad?
35
p53 is a tetramer


in vivo oligomerization-deficient p53 cannot
transactivate from genomic p53 binding sites in
transient transfection assays and cannot support
the growth of carcinoma cell lines.
36
The p53 tetramerization domain structure
Ribbon diagram illustrating the tetrameric
structure of the p53 oligomerization
domain. Very simple structure utilizing a ?
strand-turn-? helix motif. Two ? strand-turn-?
helix motifs dimerize through the formation of a
two stranded antiparallel ? sheet and the
creation by the ? helices of a small hydrophobic
core. The tetramer is formed by the formation of
a more extensive hydrophobic interface between
the four ? helices. This is an unusual four
helix bundle.
37
The p53 tetramerization domain structure
Two tumorigenic mutations, L330H and G334V, have
been mapped to the oligomerization domain of p53.
38
The tetrameric p53-DNA complex structure
The AB and CD dimers are formed by residues from
? helix H1, the Zn cluster and regions of the
L2 and L3 loops from each core subunit. The BC
and AD interfaces are small and likely DNA
sequence dependent. Each subunit recognizes
its cognate DNA site essentially as described in
the monomer p53-DNA structure.
39
The p53 AB/CD dimer-DNA complex
40
Residues that are involved in the AB and CD dimer
and dimer-dimer interfaces are mutated in some
human cancers.
DNA binding Dimer contacts Zinc ligation
Protein stability Dimer-dimer
interactions Bars show the relative
frequen- cies of tumor- derived mutations.
41
So how does all this fit together? What does
the p53 tetramer look like?
Using two different low resolution methods,
electron microscopy (EM) and small angle x-ray
scattering (SAXS), a quaternary structure of the
p53 tetramer has been determined by several
groups.
42
The p53 tetramer-DNA complex at 25 to 30 Å
resolution (the EM structure)
Tetramerization ? Domain
DNA ? DNA binding domain
? Transactivation ? domain
The structure is quite open and the domains
accessible, which makes the binding of other
proteins possible.
43
So then, how is p53 function regulated by other
proteins, in particular by MDM2?

• MDM2 (murine double minute) is an oncoprotein
  that in normal cells binds p53 in a negative
  feedback loop that helps limit the growth
  suppressing activity of p53.
• In tumors elevated MDM2 levels lead to
  constitutive inhibition of p53
• Amplification of MDM2 is seen in soft tissue
  sarcomas and in other cancers, e.g.,
  glioblastomas.
• MDM2 binds the transactivation domain of p53,
  inhibiting p53 transcription activation function.
• MDM2 is also an E3 ubiquitin ligase and targets
  p53 and itself for destruction by the proteasome.

44
Structure of MDM2

• 491 amino acid residues
• N-terminal p53 interacting domain (residues 17 to
  125), highly conserved across species
• Central acidic domain (residues 230-300)
• NLS and NES
• Zinc finger domain - unknown function
• Unique C-terminal RING domain (residues 430-480)
  - the ubiquitin ligase domain
• Walker A or P-loop motif, an NTP binding motif
• NLS
• RNA binding

45
MDM2-p53 peptide structure
MDM2 - residues 17 to 125 forms a twisted
trough binding site for p53, using its ?2 helix
and ? sheet. p53 - residues 15 to 29 form an
amphipathic ? helix
46
van der Waals and stacking interactions are key
to high affinity binding of MDM2 and p53.
p53 hydrophilic ? residues hydrophobic
? residues
MDM2 ? hydrophobic residues
47
Implications for understanding p53
transactivation domain function

• MDM2 binding and transactivation by p53 require
  overlapping sets of p53 residues
• Mutations of p53 residues F19, L22, W23 and L26,
  key interactors with MDM2, reduce or eliminate
  transactivation.
• Mutations of adjacent polar p53 residues have
  little or no effect.
• The double p53 mutant, L22Q/W23S, eliminates
  binding to the TAF31-TAF80 complex.
• Thus, MDM2 appears to inhibit p53 transactivation
  by competing with TAFs for this N-terminal p53
  amphipathic ? helix.

48
Implications for understanding p53
transactivation domain function (continued)

• Moreover, the MDM2-p53 structure provides a
  rationale for the subsequent ubiquitination and
  destruction of the p53-MDM2 complex.
• Finally, the MDM2-p53 structure provides a
  scaffold with which to design drugs that inhibit
  this interaction and thereby allow p53 to carry
  out its functions in cell cycle arrest.
• Nutlins are newly described compounds that
  inhibit p53-MDM2 interaction by binding in the
  trough.

49
If you are interested in learning more about
protein-structure function
TBA