90 Chervonenkis PPTs View free & download

Vapnik-Chervonenkis Dimension PowerPoint PPT Presentation

Vapnik-Chervonenkis Dimension - Radon Theorem. Definitions: Convex set. Convex hull: conv(S) Theorem: ... d 2 points T can be shattered. Use Radon Theorem to find S such that. conv(S) conv ...

Radon Theorem. Definitions: Convex set. Convex hull: conv(S) Theorem: ... d 2 points T can be shattered. Use Radon Theorem to find S such that. conv(S) conv ...

| PowerPoint PPT presentation | free to download

Introduction to Support Vector Machines for Data Mining PowerPoint PPT Presentation

Introduction to Support Vector Machines for Data Mining - First introduced by Vapnik and Chervonenkis in COLT-92. Bases on ... the goal is to construct a hyperplane that is close to as many points as possible. ...

First introduced by Vapnik and Chervonenkis in COLT-92. Bases on ... the goal is to construct a hyperplane that is close to as many points as possible. ...

| PowerPoint PPT presentation | free to view

Statistical Learning Theory PowerPoint PPT Presentation

Statistical Learning Theory - ... the particular that approximates d in an optimum fashion. ... Illustration of relationship between training error, confidence interval and guaranteed risk ...

... the particular that approximates d in an optimum fashion. ... Illustration of relationship between training error, confidence interval and guaranteed risk ...

| PowerPoint PPT presentation | free to download

R - R seaux de neurones artificiels ' le neurone formel ' S. Canu, ... Les r seaux de neurones pour l'apprentissage. ESSEC, le 28 Juin 2002. Phydsiologie. Les ...

R seaux de neurones artificiels ' le neurone formel ' S. Canu, ... Les r seaux de neurones pour l'apprentissage. ESSEC, le 28 Juin 2002. Phydsiologie. Les ...

| PowerPoint PPT presentation | free to download

Errors in the magnetic field vector determination with HMI PowerPoint PPT Presentation

Errors in the magnetic field vector determination with HMI - Errors in the magnetic field vector determination with HMI ... Aimee Norton. Jesper Schou. Overview. Simulations: synthesis & inversion. Adding Solar p-modes ...

Errors in the magnetic field vector determination with HMI ... Aimee Norton. Jesper Schou. Overview. Simulations: synthesis & inversion. Adding Solar p-modes ...

| PowerPoint PPT presentation | free to download

true error less PowerPoint PPT Presentation

true error less - that misclassify this example. Weighted Majority Algorithm. when b=0, equivalent to the Halving algorithm... Even algorithms that learn or change over time...

that misclassify this example. Weighted Majority Algorithm. when b=0, equivalent to the Halving algorithm... Even algorithms that learn or change over time...

| PowerPoint PPT presentation | free to download

Probably Approximately Correct Learning PowerPoint PPT Presentation

Probably Approximately Correct Learning - Then the m points can be shattered. by oriented hyperplanes if and only if ... Can you always shatter three points with a line in. Definition of VC-dimension ...

Then the m points can be shattered. by oriented hyperplanes if and only if ... Can you always shatter three points with a line in. Definition of VC-dimension ...

| PowerPoint PPT presentation | free to view

Support Vector Machines PowerPoint PPT Presentation

Support Vector Machines - Title: Visualizing and Exploring Data Author: madigan Last modified by: David Madigan Created Date: 1/25/2001 6:28:21 PM Document presentation format

Title: Visualizing and Exploring Data Author: madigan Last modified by: David Madigan Created Date: 1/25/2001 6:28:21 PM Document presentation format

| PowerPoint PPT presentation | free to download

Stefan Arnborg, KTH PowerPoint PPT Presentation

Stefan Arnborg, KTH - Antoine Augustine Cournot (1801--1877) Pioneer in stochastic processes, market theory ... Jan Walker, Pentagon spokeswoman, in Wired, Dec 2, 2002. ...

Antoine Augustine Cournot (1801--1877) Pioneer in stochastic processes, market theory ... Jan Walker, Pentagon spokeswoman, in Wired, Dec 2, 2002. ...

| PowerPoint PPT presentation | free to download

Chapter 6. Classification and Prediction PowerPoint PPT Presentation

Chapter 6. Classification and Prediction - Chapter 6. Classification and Prediction Overview Classification algorithms and methods Decision tree induction Bayesian classification Lazy learning and kNN ...

Chapter 6. Classification and Prediction Overview Classification algorithms and methods Decision tree induction Bayesian classification Lazy learning and kNN ...

| PowerPoint PPT presentation | free to download

Sampling Based Sensor-Network Deployment PowerPoint PPT Presentation

Sampling Based Sensor-Network Deployment - Sampling Based Sensor-Network Deployment Volkan Isler, Sampath Kannan and Kostas Daniilidis University of Pennsylvania Outline Background knowledge Deployment Methods ...

Sampling Based Sensor-Network Deployment Volkan Isler, Sampath Kannan and Kostas Daniilidis University of Pennsylvania Outline Background knowledge Deployment Methods ...

| PowerPoint PPT presentation | free to view

Sampling Based Sensor-Network Deployment - 3 points shattered by 8 disks: for any subset of these 3 points, ... 4 points can not be shattered: There are no disks that contain only the black points. ...

3 points shattered by 8 disks: for any subset of these 3 points, ... 4 points can not be shattered: There are no disks that contain only the black points. ...

| PowerPoint PPT presentation | free to view

SVM: Algorithms of Choice for Challenging Data PowerPoint PPT Presentation

SVM: Algorithms of Choice for Challenging Data - SVM in Oracle Database 10g: Removing the Barriers to Widespread Adoption of ... Text, image, bioinformatics. Conceptual Simplicity ...

SVM in Oracle Database 10g: Removing the Barriers to Widespread Adoption of ... Text, image, bioinformatics. Conceptual Simplicity ...

| PowerPoint PPT presentation | free to view

Support Vector Machines (SVMs) Chapter 5 (Duda et al.) PowerPoint PPT Presentation

Support Vector Machines (SVMs) Chapter 5 (Duda et al.) - Title: CS479/679 Pattern Recognition Spring 2006 Prof. Bebis Last modified by: George Bebis Document presentation format: On-screen Show (4:3)

Title: CS479/679 Pattern Recognition Spring 2006 Prof. Bebis Last modified by: George Bebis Document presentation format: On-screen Show (4:3)

| PowerPoint PPT presentation | free to download

The delta rule PowerPoint PPT Presentation

The delta rule - assumption: examples are drawn from a probability distribution. conditions for generalization ... Smooth activation functions are important for generalizing the ...

assumption: examples are drawn from a probability distribution. conditions for generalization ... Smooth activation functions are important for generalizing the ...

| PowerPoint PPT presentation | free to view

Negative Results and Open Problems PowerPoint PPT Presentation

Negative Results and Open Problems - A wealth of knowledge is lost. ... 1967 - Cover-Hart: Nearest neighbors. 1982 - Hopfield nets, distributed associative memories. ...

A wealth of knowledge is lost. ... 1967 - Cover-Hart: Nearest neighbors. 1982 - Hopfield nets, distributed associative memories. ...

| PowerPoint PPT presentation | free to download

Functional%20Analytic%20Approach%20to%20Model%20Selection PowerPoint PPT Presentation

Functional%20Analytic%20Approach%20to%20Model%20Selection - ... space We assume Generalization Measure in Functional Hilbert Space A functional Hilbert space is specified by Set of functions ... Trigonometric polynomial RKHS ...

... space We assume Generalization Measure in Functional Hilbert Space A functional Hilbert space is specified by Set of functions ... Trigonometric polynomial RKHS ...

| PowerPoint PPT presentation | free to download

RAKESH VOHRA PowerPoint PPT Presentation

RAKESH VOHRA - CS and ECON RAKESH VOHRA KELLOGG SCHOOL OF MANAGEMENT NORTHWESTERN UNIVERSITY Brief History of Interactions Brief History of Interactions So, 5 minutes?

CS and ECON RAKESH VOHRA KELLOGG SCHOOL OF MANAGEMENT NORTHWESTERN UNIVERSITY Brief History of Interactions Brief History of Interactions So, 5 minutes?

| PowerPoint PPT presentation | free to view

CS 391L: Machine Learning: Computational Learning Theory PowerPoint PPT Presentation

CS 391L: Machine Learning: Computational Learning Theory - CS 391L: Machine Learning: Computational Learning Theory Raymond J. Mooney University of Texas at Austin

CS 391L: Machine Learning: Computational Learning Theory Raymond J. Mooney University of Texas at Austin

| PowerPoint PPT presentation | free to download

Statistical Learning Theory and Support Vector Machines PowerPoint PPT Presentation

Statistical Learning Theory and Support Vector Machines - ... 1999. [20] D.J.C. MacKay, Introduction to Gaussian Processes, Cambridge University, http://wol.ra.phy.cam.ac.uk/mackay/, 1998 ... pp. 211-231, 1998. [29 ...

... 1999. [20] D.J.C. MacKay, Introduction to Gaussian Processes, Cambridge University, http://wol.ra.phy.cam.ac.uk/mackay/, 1998 ... pp. 211-231, 1998. [29 ...

| PowerPoint PPT presentation | free to download

Introducci - Title: Introducci n al Dise o de Experimentos para el Reconocimiento de Patrones Author: Quiliano Isaac Moro Sancho Last modified by: Dpto. de Inform tica

Title: Introducci n al Dise o de Experimentos para el Reconocimiento de Patrones Author: Quiliano Isaac Moro Sancho Last modified by: Dpto. de Inform tica

| PowerPoint PPT presentation | free to download

A general agnostic active learning algorithm PowerPoint PPT Presentation

A general agnostic active learning algorithm - A general agnostic active learning algorithm Claire Monteleoni UC San Diego Joint work with Sanjoy Dasgupta and Daniel Hsu, UCSD. Active learning Many machine ...

A general agnostic active learning algorithm Claire Monteleoni UC San Diego Joint work with Sanjoy Dasgupta and Daniel Hsu, UCSD. Active learning Many machine ...

| PowerPoint PPT presentation | free to download

Data Mining: Concepts and Techniques (2nd ed.) PowerPoint PPT Presentation

Data Mining: Concepts and Techniques (2nd ed.) - Data Mining: Concepts and Techniques (2nd ed.) Chapter 6 Classification: Advanced Methods * *

Data Mining: Concepts and Techniques (2nd ed.) Chapter 6 Classification: Advanced Methods * *

| PowerPoint PPT presentation | free to view

Data Mining - Data Mining Lecture 12

Data Mining Lecture 12

| PowerPoint PPT presentation | free to download

Extrinsic Regularization in Parameter Optimization for Support Vector Machines PowerPoint PPT Presentation

Extrinsic Regularization in Parameter Optimization for Support Vector Machines - Title: Slide 1 Author: Matthew D. Boardman Last modified by: Matthew D. Boardman Created Date: 6/1/2006 3:30:16 PM Document presentation format: On-screen Show

Title: Slide 1 Author: Matthew D. Boardman Last modified by: Matthew D. Boardman Created Date: 6/1/2006 3:30:16 PM Document presentation format: On-screen Show

| PowerPoint PPT presentation | free to download

Data Mining - Data Mining Lecture 12

Data Mining Lecture 12

| PowerPoint PPT presentation | free to download

Presentation on Neural Networks. PowerPoint PPT Presentation

Presentation on Neural Networks. - Presentation on Neural Networks. SINGLE LAYER PERCEPTRON Single Layer Perceptron (Working Example) Single layer Perceptron does binary classification and then does ...

Presentation on Neural Networks. SINGLE LAYER PERCEPTRON Single Layer Perceptron (Working Example) Single layer Perceptron does binary classification and then does ...

| PowerPoint PPT presentation | free to download

Les SVM : S - IIE & CNRS - Universit de Paris-Sud, Orsay. antoine@lri.fr http://www.lri.fr/~antoine. Les ... On cherche h sous forme d'une fonction lin aire : h(x) = w.x b ...

IIE & CNRS - Universit de Paris-Sud, Orsay. antoine@lri.fr http://www.lri.fr/~antoine. Les ... On cherche h sous forme d'une fonction lin aire : h(x) = w.x b ...

| PowerPoint PPT presentation | free to view

CS 570 Artificial Intelligence Introduction to Statistical Learning Theory PowerPoint PPT Presentation

CS 570 Artificial Intelligence Introduction to Statistical Learning Theory - Oct. 13, 2003. Jahwan Kim CS 570 Artificial Intelligence. 1. CS 570 Artificial Intelligence ... Oct. 13, 2003. Jahwan Kim CS 570 Artificial Intelligence. 5 ...

Oct. 13, 2003. Jahwan Kim CS 570 Artificial Intelligence. 1. CS 570 Artificial Intelligence ... Oct. 13, 2003. Jahwan Kim CS 570 Artificial Intelligence. 5 ...

| PowerPoint PPT presentation | free to view

CS 391L: Machine Learning: Computational Learning Theory - A hypothesis space is said to shatter a set of instances iff for every partition ... No five instances can be shattered since there can be at most 4 distinct extreme ...

A hypothesis space is said to shatter a set of instances iff for every partition ... No five instances can be shattered since there can be at most 4 distinct extreme ...

| PowerPoint PPT presentation | free to download

Important Ideas in Bayesian Models PowerPoint PPT Presentation

Important Ideas in Bayesian Models - key step of parameter learning is inference of latent variables ... Markov chain Monte Carlo. particle filters. variational approximations ...

key step of parameter learning is inference of latent variables ... Markov chain Monte Carlo. particle filters. variational approximations ...

| PowerPoint PPT presentation | free to view

CS 9633 Machine Learning PowerPoint PPT Presentation

CS 9633 Machine Learning - (Classifying Executables) Three Classes (Malicious, Boring, Funny) Features ... Consider executables problem where instances are conjunctions of boolean features: ...

(Classifying Executables) Three Classes (Malicious, Boring, Funny) Features ... Consider executables problem where instances are conjunctions of boolean features: ...

| PowerPoint PPT presentation | free to view

Generalizacin y Regularizacin en Redes Neuronales PowerPoint PPT Presentation

Generalizacin y Regularizacin en Redes Neuronales - Buena aproximaci n VS sobre-ajuste (overfitting) ajustar modelo de ... well-posed vs ill ... double backprop (Drucker y LeCun '92) 12/26/09 ...

Buena aproximaci n VS sobre-ajuste (overfitting) ajustar modelo de ... well-posed vs ill ... double backprop (Drucker y LeCun '92) 12/26/09 ...

| PowerPoint PPT presentation | free to view

Une introduction aux machines PowerPoint PPT Presentation

Une introduction aux machines - Une introduction aux machines vecteurs supports (SVM) Adapt de Martin Law, Antoine Cornu jols et autres sources sur Internet

Une introduction aux machines vecteurs supports (SVM) Adapt de Martin Law, Antoine Cornu jols et autres sources sur Internet

| PowerPoint PPT presentation | free to download

titel - The model f can shatter a set of data points if, for all assignments of labels ... maximum h such that some data point set of cardinality h can be shattered by f. ...

The model f can shatter a set of data points if, for all assignments of labels ... maximum h such that some data point set of cardinality h can be shattered by f. ...

| PowerPoint PPT presentation | free to view

Data Mining ???? - ... (the one that minimizes classification error on unseen ... applications Credit approval Target marketing Medical diagnosis Fraud detection Classification vs ...

... (the one that minimizes classification error on unseen ... applications Credit approval Target marketing Medical diagnosis Fraud detection Classification vs ...

| PowerPoint PPT presentation | free to download

Document Classification PowerPoint PPT Presentation

Document Classification - Given a collection of words determine the best fit category for this collection of words. ... Heavy use of statistical formulas and mathematics. Classification ...

Given a collection of words determine the best fit category for this collection of words. ... Heavy use of statistical formulas and mathematics. Classification ...

| PowerPoint PPT presentation | free to view

A Methodology Using Support Vector Machines for Load Forecasting PowerPoint PPT Presentation

A Methodology Using Support Vector Machines for Load Forecasting - These s are adapted from Presentation. given by researchers in Purdue University ... Real world data were provided by ComEd (An Exelon Company) ...

These s are adapted from Presentation. given by researchers in Purdue University ... Real world data were provided by ComEd (An Exelon Company) ...

| PowerPoint PPT presentation | free to view

Data Mining ???? - Title: Data Mining ( ) Author: myday Keywords: Data Mining, Description: Data Mining ( ) Last modified by: MY DAY

Title: Data Mining ( ) Author: myday Keywords: Data Mining, Description: Data Mining ( ) Last modified by: MY DAY

| PowerPoint PPT presentation | free to download

A Methodology Using Support Vector Machines for Shortterm Load Forecasting PowerPoint PPT Presentation

A Methodology Using Support Vector Machines for Shortterm Load Forecasting - Used by Power Utilities (e.g.,ComEd, An Exelon Company) 8. Empirical Risk Minimization (ERM) ... Real world data were provided by ComEd (An Exelon Company) ...

Used by Power Utilities (e.g.,ComEd, An Exelon Company) 8. Empirical Risk Minimization (ERM) ... Real world data were provided by ComEd (An Exelon Company) ...

| PowerPoint PPT presentation | free to view

Multimedia search: From Lab to Web PowerPoint PPT Presentation

Multimedia search: From Lab to Web - Learning is useful as a system construction method ... Sigmoid. Implicit mapping to a higher dimensional space where linear separation is possible. ...

Learning is useful as a system construction method ... Sigmoid. Implicit mapping to a higher dimensional space where linear separation is possible. ...

| PowerPoint PPT presentation | free to download

Efficient Text and Semi-structured Data Mining: Towards Knowledge Discovery in the Cyberspace PowerPoint PPT Presentation

Efficient Text and Semi-structured Data Mining: Towards Knowledge Discovery in the Cyberspace - CACA. TGTTTCTGT. AGGAGGT. Web pages, XML/SGML archives. Genome databases. E-mails, text files ... CACA. AGGAT. CCAA. CACA. AGGAT. CCAA. GTGTCACAAATTCTGTAGTATCA ...

CACA. TGTTTCTGT. AGGAGGT. Web pages, XML/SGML archives. Genome databases. E-mails, text files ... CACA. AGGAT. CCAA. CACA. AGGAT. CCAA. GTGTCACAAATTCTGTAGTATCA ...

| PowerPoint PPT presentation | free to view

Feedforward Neural Networks. Classification and Approximation PowerPoint PPT Presentation

Feedforward Neural Networks. Classification and Approximation - Feedforward Neural Networks. Classification and Approximation Classification and Approximation Problems BackPropagation (BP) Neural Networks Radial Basis Function ...

Feedforward Neural Networks. Classification and Approximation Classification and Approximation Problems BackPropagation (BP) Neural Networks Radial Basis Function ...

| PowerPoint PPT presentation | free to view

Big Data Mining ?????? PowerPoint PPT Presentation

Big Data Mining ?????? - Title: Big Data Mining ( ) Author: myday Keywords: Big Data Mining ( ) Description: Data Mining ( ) Last modified by

Title: Big Data Mining ( ) Author: myday Keywords: Big Data Mining ( ) Description: Data Mining ( ) Last modified by

| PowerPoint PPT presentation | free to download

Project Presentation for ECE 1528 PowerPoint PPT Presentation

Project Presentation for ECE 1528 - Achievable rate region for a single source-destination pair. Application to the AWGN Channel ... Introduce a Voronoi Tessellation with some eccentricity properties ...

Achievable rate region for a single source-destination pair. Application to the AWGN Channel ... Introduce a Voronoi Tessellation with some eccentricity properties ...

| PowerPoint PPT presentation | free to view

CSC321: Lecture 27: Support Vector Machines PowerPoint PPT Presentation

CSC321: Lecture 27: Support Vector Machines - ... to get a low error rate on unseen data. It would be really helpful if we could get a guarantee ... In the original input space we get a curved decision surface. ...

... to get a low error rate on unseen data. It would be really helpful if we could get a guarantee ... In the original input space we get a curved decision surface. ...

| PowerPoint PPT presentation | free to download

Support Vector Machine (SVM) Classification PowerPoint PPT Presentation

Support Vector Machine (SVM) Classification - Title: Machine Learning CSCI 5622 Author: GRASP LAB Last modified by: latecki Created Date: 8/27/2001 4:40:02 PM Document presentation format: On-screen Show (4:3)

Title: Machine Learning CSCI 5622 Author: GRASP LAB Last modified by: latecki Created Date: 8/27/2001 4:40:02 PM Document presentation format: On-screen Show (4:3)

| PowerPoint PPT presentation | free to download

Machine%20Learning:%20Lecture%208 PowerPoint PPT Presentation

Machine%20Learning:%20Lecture%208 - Computational Learning. Theory (Based on Chapter 7 of Mitchell T.., Machine ... algorithms, and let k be the minimum number of mistakes made by any algorithm ...

Computational Learning. Theory (Based on Chapter 7 of Mitchell T.., Machine ... algorithms, and let k be the minimum number of mistakes made by any algorithm ...

| PowerPoint PPT presentation | free to download

Notions of interest: efficiency, accuracy, complexity PowerPoint PPT Presentation

Notions of interest: efficiency, accuracy, complexity - Use the notion of a shattering of a set of instances to measure the complexity ... shattered. Instance space X. CS 8751 ML & KDD. Computational Learning Theory. 15 ...

Use the notion of a shattering of a set of instances to measure the complexity ... shattered. Instance space X. CS 8751 ML & KDD. Computational Learning Theory. 15 ...

| PowerPoint PPT presentation | free to download

Pattern representation PowerPoint PPT Presentation

Pattern representation - Pattern representation & the future of pattern recognition Lev Goldfarb ETS group Faculty of Computer Science UNB Fredericton, Canada Outline [ The wisdom of modern ...

Pattern representation & the future of pattern recognition Lev Goldfarb ETS group Faculty of Computer Science UNB Fredericton, Canada Outline [ The wisdom of modern ...

| PowerPoint PPT presentation | free to download

Data-Driven Knowledge Discovery and Philosophy of Science PowerPoint PPT Presentation

Data-Driven Knowledge Discovery and Philosophy of Science - Data-Driven Knowledge Discovery and Philosophy of Science Vladimir Cherkassky University of Minnesota cherk001@umn.edu Presented at Ockham s Razor Workshop, CMU ...

Data-Driven Knowledge Discovery and Philosophy of Science Vladimir Cherkassky University of Minnesota cherk001@umn.edu Presented at Ockham s Razor Workshop, CMU ...

| PowerPoint PPT presentation | free to view

An Introduction to Support Vector Machines PowerPoint PPT Presentation

An Introduction to Support Vector Machines - What is a good decision boundary? Two classes, not linearly separable ... Sigmoid with parameter and. It does not satisfy the Mercer condition on all and ...

What is a good decision boundary? Two classes, not linearly separable ... Sigmoid with parameter and. It does not satisfy the Mercer condition on all and ...

| PowerPoint PPT presentation | free to view

An Introduction to Support Vector Machines - Example of SVM Applications: Handwriting Recognition. 11/4/09. CSE 802. Prepared by Martin Law ... correlation analysis, kernel k-means, 1-class SVM are some examples ...

Example of SVM Applications: Handwriting Recognition. 11/4/09. CSE 802. Prepared by Martin Law ... correlation analysis, kernel k-means, 1-class SVM are some examples ...

| PowerPoint PPT presentation | free to download

CHAPTER 13 MODELING CONSIDERATIONS AND STATISTICAL INFORMATION PowerPoint PPT Presentation

CHAPTER 13 MODELING CONSIDERATIONS AND STATISTICAL INFORMATION - Step 2 (error calculation) Based on estimate for from Step 1 (i th training subset), calculate MSE (or other measure) with data in i th test subset. ...

Step 2 (error calculation) Based on estimate for from Step 1 (i th training subset), calculate MSE (or other measure) with data in i th test subset. ...

| PowerPoint PPT presentation | free to download

Pattern representation - We are all agreed,' he said, 'that your theory is crazy. ... The objection that they are not crazy enough applies to all the attempts which ...

We are all agreed,' he said, 'that your theory is crazy. ... The objection that they are not crazy enough applies to all the attempts which ...

| PowerPoint PPT presentation | free to download

Thursday, September 2, 1999 PowerPoint PPT Presentation

Thursday, September 2, 1999 - Kansas State University. Department of Computing and Information Sciences ... with m examples of c is less than | H | (1 - )m , Quod Erat Demonstrandum ...

Kansas State University. Department of Computing and Information Sciences ... with m examples of c is less than | H | (1 - )m , Quod Erat Demonstrandum ...

| PowerPoint PPT presentation | free to download

Chervonenkis PowerPoint PPT Presentations