76 20bp PPTs View free & download

The%20BP%20Story PowerPoint PPT Presentation

The%20BP%20Story - Some Mobil employees became part of BP staff post dissolution of JV in Europe ... BP is one of the world's largest gas marketer and traders providing gas to ...

Some Mobil employees became part of BP staff post dissolution of JV in Europe ... BP is one of the world's largest gas marketer and traders providing gas to ...

| PowerPoint PPT presentation | free to download

Biological Computing PowerPoint PPT Presentation

Biological Computing - 1. Biological Computing DNA solution. Presented by ... Ligation reaction (annealing) Each vertex encoded by random 20bp ... 1019 op/J (in ligation step) ...

1. Biological Computing DNA solution. Presented by ... Ligation reaction (annealing) Each vertex encoded by random 20bp ... 1019 op/J (in ligation step) ...

| PowerPoint PPT presentation | free to download

Arabidopsis Thaliana Gene AT5G58610 PowerPoint PPT Presentation

Arabidopsis Thaliana Gene AT5G58610 - Arabidopsis Thaliana Gene AT5G58610 Nancy Gallardo HC70AL What Protein Does AT5G58610 Code for? Regulates gene expression 1065 amino acids What's Around Gene AT5G58610 ?

Arabidopsis Thaliana Gene AT5G58610 Nancy Gallardo HC70AL What Protein Does AT5G58610 Code for? Regulates gene expression 1065 amino acids What's Around Gene AT5G58610 ?

| PowerPoint PPT presentation | free to view

??? DNA??? - Title: DNA Author: yyl Last modified by: Created Date: 7/3/2003 1:49:14 AM Document presentation format:

Title: DNA Author: yyl Last modified by: Created Date: 7/3/2003 1:49:14 AM Document presentation format:

| PowerPoint PPT presentation | free to view

Real-Time Quantitative PCR Basis - Real-Time Quantitative PCR Basis

Real-Time Quantitative PCR Basis

| PowerPoint PPT presentation | free to download

Hierarchical DNA Memory based on Nested PCR PowerPoint PPT Presentation

Hierarchical DNA Memory based on Nested PCR - 8th International Workshop on DNA-based Computers, volume 2568 of LNCS. ... Data1. amplification. Non-amplification. 35mer. Laboratory Experiments ...

8th International Workshop on DNA-based Computers, volume 2568 of LNCS. ... Data1. amplification. Non-amplification. 35mer. Laboratory Experiments ...

| PowerPoint PPT presentation | free to view

Real-Time Quantitative PCR Basis - Basis ABI Prism 7900HT real-time PCR instrument Content Principles of quantification Methods of quantification Applications The polymerase chain reaction (PCR) has ...

Basis ABI Prism 7900HT real-time PCR instrument Content Principles of quantification Methods of quantification Applications The polymerase chain reaction (PCR) has ...

| PowerPoint PPT presentation | free to download

Basel II, Securitization, and Credit Risk PowerPoint PPT Presentation

Basel II, Securitization, and Credit Risk - Basel II, Securitization, and Credit Risk Hsien-hsing Liao / Department of Finance/National Taiwan U. Framework of Basel II ...

Basel II, Securitization, and Credit Risk Hsien-hsing Liao / Department of Finance/National Taiwan U. Framework of Basel II ...

| PowerPoint PPT presentation | free to download

Risk Management what went wrong PowerPoint PPT Presentation

Risk Management what went wrong - What's the right measure capital base, market perception ? ... Some egregious examples between risk-neutral pricing and assumed real world ...

What's the right measure capital base, market perception ? ... Some egregious examples between risk-neutral pricing and assumed real world ...

| PowerPoint PPT presentation | free to view

Arabidopsis Gene At1G49560 PowerPoint PPT Presentation

Arabidopsis Gene At1G49560 - MYB (Myeloblast) consists of a 203 family transcription factor proteins first ... Kristin Gill. What Protein does it encode for? SET- Domain Containing Protein ...

MYB (Myeloblast) consists of a 203 family transcription factor proteins first ... Kristin Gill. What Protein does it encode for? SET- Domain Containing Protein ...

| PowerPoint PPT presentation | free to view

DNA Solution of the Maximal Clique Problem PowerPoint PPT Presentation

DNA Solution of the Maximal Clique Problem - Every vertex is connected to every other vertex. Represented by an N-digit ... Ex) Afl II V0, Hind III V1, Spe I V2, etc. Parallel overlap assembly (POA) ...

Every vertex is connected to every other vertex. Represented by an N-digit ... Ex) Afl II V0, Hind III V1, Spe I V2, etc. Parallel overlap assembly (POA) ...

| PowerPoint PPT presentation | free to download

DNA Fingerprinting: PowerPoint PPT Presentation

DNA Fingerprinting: - Tandem repeats are short DNA sequences that are non-coding and repeat at specific loci a variable ... E.g. TCATTCATTCATTCATTCAT is a short tandem repeat (STR) ...

Tandem repeats are short DNA sequences that are non-coding and repeat at specific loci a variable ... E.g. TCATTCATTCATTCATTCAT is a short tandem repeat (STR) ...

| PowerPoint PPT presentation | free to download

Overview of ICAT Proteomics : - Overview of ICAT Proteomics :

Overview of ICAT Proteomics :

| PowerPoint PPT presentation | free to view

Microbial Genetics PowerPoint PPT Presentation

Microbial Genetics - Cold- or temperature-sensitive: enzyme function is restricted to ... Recent Science article. Comparing gene families. Escherichia coli map. Next Tues. NO quiz ...

Cold- or temperature-sensitive: enzyme function is restricted to ... Recent Science article. Comparing gene families. Escherichia coli map. Next Tues. NO quiz ...

| PowerPoint PPT presentation | free to view

Structure and evolution of plant sex chromosomes PowerPoint PPT Presentation

Structure and evolution of plant sex chromosomes - Title: Structure and evolution of plant sex chromosomes Author: Administrator Last modified by: Eduard Kejnovsk Created Date: 2/5/2004 1:54:08 PM

Title: Structure and evolution of plant sex chromosomes Author: Administrator Last modified by: Eduard Kejnovsk Created Date: 2/5/2004 1:54:08 PM

| PowerPoint PPT presentation | free to view

Alternative Splicing from ESTs PowerPoint PPT Presentation

Alternative Splicing from ESTs - Xenopus laevis (African clawed frog) 359,901. dbEST release 20 February 2004. EST lengths ... (South African Bioinformatics Institute) UniGene. Species UniGene ...

Xenopus laevis (African clawed frog) 359,901. dbEST release 20 February 2004. EST lengths ... (South African Bioinformatics Institute) UniGene. Species UniGene ...

| PowerPoint PPT presentation | free to download

Structure and evolution of plant sex chromosomes - Title: Structure and evolution of plant sex chromosomes Author: Administrator Last modified by: Eduard Kejnovsk Created Date: 2/5/2004 1:54:08 PM

Title: Structure and evolution of plant sex chromosomes Author: Administrator Last modified by: Eduard Kejnovsk Created Date: 2/5/2004 1:54:08 PM

| PowerPoint PPT presentation | free to download

Small RNA Sample Preparation PowerPoint PPT Presentation

Small RNA Sample Preparation - Customers should carry out a ... and the integrity of RNA judged upon staining with. ethidium bromide. High quality, intact RNA will show a 28S rRNA band at ...

Customers should carry out a ... and the integrity of RNA judged upon staining with. ethidium bromide. High quality, intact RNA will show a 28S rRNA band at ...

| PowerPoint PPT presentation | free to view

Forensic DNA Analysis PowerPoint PPT Presentation

Forensic DNA Analysis - Forensic DNA Analysis. Forensics, pertaining to the courts ... This process requires primers that anneal just outside the VNTR. Short Tandem Repeats (STR) ...

Forensic DNA Analysis. Forensics, pertaining to the courts ... This process requires primers that anneal just outside the VNTR. Short Tandem Repeats (STR) ...

| PowerPoint PPT presentation | free to view

Dise - Dise o de primers

Dise o de primers

| PowerPoint PPT presentation | free to download

Setelah mengikuti kuliah ini mahasiswa dapat menjelaskan bahan genetik PowerPoint PPT Presentation

Setelah mengikuti kuliah ini mahasiswa dapat menjelaskan bahan genetik - Pokok Bahasan: Bahan genetik Tujuan Instruksional Khusus : Setelah mengikuti kuliah ini mahasiswa dapat menjelaskan bahan genetik 2 Kromosom Di dalam sel ...

Pokok Bahasan: Bahan genetik Tujuan Instruksional Khusus : Setelah mengikuti kuliah ini mahasiswa dapat menjelaskan bahan genetik 2 Kromosom Di dalam sel ...

| PowerPoint PPT presentation | free to download

Rupee Interest Rate Swaps PowerPoint PPT Presentation

Rupee Interest Rate Swaps - Title: No Slide Title Author: Sushir Lohia Last modified by: IN00024759 Created Date: 6/28/1999 5:27:19 AM Document presentation format: A4 Paper (210x297 mm)

Title: No Slide Title Author: Sushir Lohia Last modified by: IN00024759 Created Date: 6/28/1999 5:27:19 AM Document presentation format: A4 Paper (210x297 mm)

| PowerPoint PPT presentation | free to view

SERIAL ANALYSIS OF GENE EXPRESSION AND CANCER RESEARCH PowerPoint PPT Presentation

SERIAL ANALYSIS OF GENE EXPRESSION AND CANCER RESEARCH - These copies are then sequenced, using machines that can read the nucleotides in ... Chi square test. SAGE software searches GenBank for matches to each tag ...

These copies are then sequenced, using machines that can read the nucleotides in ... Chi square test. SAGE software searches GenBank for matches to each tag ...

| PowerPoint PPT presentation | free to download

MOPAC: Motif-finding by Preprocessing and Agglomerative Clustering from Microarrays PowerPoint PPT Presentation

MOPAC: Motif-finding by Preprocessing and Agglomerative Clustering from Microarrays - MOPAC: Motif-finding by. Preprocessing and Agglomerative. Clustering from Microarrays ... Many algorithms exist for motif finding. assume cluster (gene set) is ...

MOPAC: Motif-finding by. Preprocessing and Agglomerative. Clustering from Microarrays ... Many algorithms exist for motif finding. assume cluster (gene set) is ...

| PowerPoint PPT presentation | free to download

Financial Oxygen an electronic marketplace PowerPoint PPT Presentation

Financial Oxygen an electronic marketplace - Mutual fund indictments. FNMA / FHLMC. Terrorism ... Washington Mutual - CONFIDENTIAL - 18. Deposit Pricing. Customer Segmentation: Product Attributes ...

Mutual fund indictments. FNMA / FHLMC. Terrorism ... Washington Mutual - CONFIDENTIAL - 18. Deposit Pricing. Customer Segmentation: Product Attributes ...

| PowerPoint PPT presentation | free to view

What is BLAST? BLAST (Basic Local Alignment Search Tool) is PowerPoint PPT Presentation

What is BLAST? BLAST (Basic Local Alignment Search Tool) is - What is BLAST? BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases ...

What is BLAST? BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases ...

| PowerPoint PPT presentation | free to view

Isolation of Microsatellite Loci PowerPoint PPT Presentation

Isolation of Microsatellite Loci - Phrynosomatid lizard that ranges from southern Texas and throughout Mexico at ... The lizard are polygynous, viviparous and sexually dimorphic. ...

Phrynosomatid lizard that ranges from southern Texas and throughout Mexico at ... The lizard are polygynous, viviparous and sexually dimorphic. ...

| PowerPoint PPT presentation | free to view

The Global Credit Crunch What does it mean for Income Investing Andrew Smith Managing Director Austr PowerPoint PPT Presentation

The Global Credit Crunch What does it mean for Income Investing Andrew Smith Managing Director Austr - Credit Ratings are not: recommendations to buy or sell ... B' ratings indicate that significant credit risk is present, but a limited ...

Credit Ratings are not: recommendations to buy or sell ... B' ratings indicate that significant credit risk is present, but a limited ...

| PowerPoint PPT presentation | free to view

Modelling the Global FX Market M A H Dempster Centre for Financial Research Judge Institute of Management University of Cambridge PowerPoint PPT Presentation

Modelling the Global FX Market M A H Dempster Centre for Financial Research Judge Institute of Management University of Cambridge - 2004 Centre for Financial Research, Judge Institute of Management, University of Cambridge ... University of Cambridge. Cambridge Systems Associates Limited ...

2004 Centre for Financial Research, Judge Institute of Management, University of Cambridge ... University of Cambridge. Cambridge Systems Associates Limited ...

| PowerPoint PPT presentation | free to view

The Benefits of Sex PowerPoint PPT Presentation

The Benefits of Sex - of variation for the population, ready to respond to. environmental change/challenge. ... cross these plants, this is the Parental generation (P) ...

of variation for the population, ready to respond to. environmental change/challenge. ... cross these plants, this is the Parental generation (P) ...

| PowerPoint PPT presentation | free to view

OFFENSIVE LINE PowerPoint PPT Presentation

OFFENSIVE LINE - offensive line offensive line patterns 5s: 5 yards straight 5dw: 5 yard duck walk 10s: 10 yard straight 10 sl: 10 scramble left step group rip it scramble

offensive line offensive line patterns 5s: 5 yards straight 5dw: 5 yard duck walk 10s: 10 yard straight 10 sl: 10 scramble left step group rip it scramble

| PowerPoint PPT presentation | free to download

Biol 568 Advanced Topics in Molecular Genetics PowerPoint PPT Presentation

Biol 568 Advanced Topics in Molecular Genetics - ... present in some promoters Binding site for alpha subunits Fig 9.27 Typical promoter Analysis of proteins binding to DNA DNA footprinting locates specific DNA ...

... present in some promoters Binding site for alpha subunits Fig 9.27 Typical promoter Analysis of proteins binding to DNA DNA footprinting locates specific DNA ...

| PowerPoint PPT presentation | free to view

Lecture 16 Molecular Analysis of Microbial Communities PowerPoint PPT Presentation

Lecture 16 Molecular Analysis of Microbial Communities - Lecture 16. Molecular Analysis of Microbial Communities ... Agar plate antibiotic. No plasmid. x. x. x. x. x. No insert. Back to microbial communities...

Lecture 16. Molecular Analysis of Microbial Communities ... Agar plate antibiotic. No plasmid. x. x. x. x. x. No insert. Back to microbial communities...

| PowerPoint PPT presentation | free to view

Credit Derivatives PowerPoint PPT Presentation

Credit Derivatives - Off-balance sheet financial instruments that allow end users to buy. and sell ... or electronically displayed financial news sources. Common credit derivatives ...

Off-balance sheet financial instruments that allow end users to buy. and sell ... or electronically displayed financial news sources. Common credit derivatives ...

| PowerPoint PPT presentation | free to download

Dise - Dise o de primers Escenarios frecuentes en el dise o de primers: Secuencia de DNA conocida Diagn stico, genotipificaci n Tener cuidado si es DNA o cDNA Secuencia ...

Dise o de primers Escenarios frecuentes en el dise o de primers: Secuencia de DNA conocida Diagn stico, genotipificaci n Tener cuidado si es DNA o cDNA Secuencia ...

| PowerPoint PPT presentation | free to download

China Petroleum PowerPoint PPT Presentation

China Petroleum - Cost Cutting. 2002 Interim Actual Cost Cutting RMB 1,259MM. Cost cutting in raw material procurement e.g. crude oil. Reduce energy and material consumption ...

Cost Cutting. 2002 Interim Actual Cost Cutting RMB 1,259MM. Cost cutting in raw material procurement e.g. crude oil. Reduce energy and material consumption ...

| PowerPoint PPT presentation | free to view

Princip prutokov PowerPoint PPT Presentation

Princip prutokov - Title: Principles of Flow Cytometry Author: Tomas Kalina Last modified by: VB Created Date: 10/28/2005 10:29:00 AM Document presentation format: P edv d n na ...

Title: Principles of Flow Cytometry Author: Tomas Kalina Last modified by: VB Created Date: 10/28/2005 10:29:00 AM Document presentation format: P edv d n na ...

| PowerPoint PPT presentation | free to view

What is BLAST PowerPoint PPT Presentation

What is BLAST - 'local' means it searches and aligns sequence segments, rather than align the ... acidic-, basic- or proline-rich regions) determined by SEG or DUST program. ...

'local' means it searches and aligns sequence segments, rather than align the ... acidic-, basic- or proline-rich regions) determined by SEG or DUST program. ...

| PowerPoint PPT presentation | free to view

Common Stock QuosiIPO - Common Stock QuosiIPO

Common Stock QuosiIPO

| PowerPoint PPT presentation | free to view

DNA Technology and Genomics PowerPoint PPT Presentation

DNA Technology and Genomics - DNA Technology and Genomics Transformation using a gene gun This method of introducing foreign DNA into plant cells, literally shoots it directly through cell walls ...

DNA Technology and Genomics Transformation using a gene gun This method of introducing foreign DNA into plant cells, literally shoots it directly through cell walls ...

| PowerPoint PPT presentation | free to download

Flow Cytometry Basic Training PowerPoint PPT Presentation

Flow Cytometry Basic Training - Introduce the research community to the progressively useful ... Cell viability. Intracellular protein staining. pH changes. Cell tracking and proliferation ...

Introduce the research community to the progressively useful ... Cell viability. Intracellular protein staining. pH changes. Cell tracking and proliferation ...

| PowerPoint PPT presentation | free to view

Linkage analysis PowerPoint PPT Presentation

Linkage analysis - Standard rules for LOD-scores 3 significant linkage 2

Standard rules for LOD-scores 3 significant linkage 2

| PowerPoint PPT presentation | free to view

Slovak Republic PowerPoint PPT Presentation

| PowerPoint PPT presentation | free to view

Transcription PowerPoint PPT Presentation

Transcription - ( C) hamster CHO cells, with some mitochondria shown in the inset. ( D) actin filiments. ... for gene x. gene y (reporter gene) ...

( C) hamster CHO cells, with some mitochondria shown in the inset. ( D) actin filiments. ... for gene x. gene y (reporter gene) ...

| PowerPoint PPT presentation | free to download

Resonance Energy Transfer PowerPoint PPT Presentation

Resonance Energy Transfer - Plasmon resonances in the visible range with large extinction coefficient (105 /cm/M) ... Plasmon Coupling to nearest NPs - Photoluminescence as Gold QDs. ...

Plasmon resonances in the visible range with large extinction coefficient (105 /cm/M) ... Plasmon Coupling to nearest NPs - Photoluminescence as Gold QDs. ...

| PowerPoint PPT presentation | free to view

SERIAL ANALYSIS OF GENE EXPRESSION AND CANCER RESEARCH - Two different genes could have the same tag and the same ... Used in mouse and human ... by the incorporation of a one tube' procedure for all steps. ...

Two different genes could have the same tag and the same ... Used in mouse and human ... by the incorporation of a one tube' procedure for all steps. ...

| PowerPoint PPT presentation | free to view

Regulatory Networks in the Drosophila Blastoderm - Regulatory Networks in the Drosophila Blastoderm

Regulatory Networks in the Drosophila Blastoderm

| PowerPoint PPT presentation | free to view

BRNO, Czech Republic PowerPoint PPT Presentation

BRNO, Czech Republic - search for primer annealing sites (PRIMEX 1.0) - mathematical model of the PCR reaction ... predicts PCR products for a set of primers and template ...

search for primer annealing sites (PRIMEX 1.0) - mathematical model of the PCR reaction ... predicts PCR products for a set of primers and template ...

| PowerPoint PPT presentation | free to view

Linkage analysis - ... Sanger sequencing only possible after selection Massively parallel sequencing possible prior to or after selection RNA sequencing exome sequencing genome ...

... Sanger sequencing only possible after selection Massively parallel sequencing possible prior to or after selection RNA sequencing exome sequencing genome ...

| PowerPoint PPT presentation | free to view

Molecular Biology Primer - Molecular Biology Primer

Molecular Biology Primer

| PowerPoint PPT presentation | free to download

Genome Sequencing, Fragment Assembly, and the use of Consed, Phred, and Phrap PowerPoint PPT Presentation

Genome Sequencing, Fragment Assembly, and the use of Consed, Phred, and Phrap - UNIX (free to academic users) DNA assembly package for high through-put ... Trimming of the vector sequence to yield only the insert DNA is an example of ...

UNIX (free to academic users) DNA assembly package for high through-put ... Trimming of the vector sequence to yield only the insert DNA is an example of ...

| PowerPoint PPT presentation | free to view

Credit Derivatives - Credit default swaps - 73 ... Credit Default Swaps ... 20% to $20.65 per share, and five-year credit default swap (CDS) spreads jumped ...

Credit default swaps - 73 ... Credit Default Swaps ... 20% to $20.65 per share, and five-year credit default swap (CDS) spreads jumped ...

| PowerPoint PPT presentation | free to view

Part 2 - Credit default swaps. Equity-linked swaps. 2. Asset swaps ... Many investors use Asset Swaps to 'arbitrage' the credit markets, as in many ...

Credit default swaps. Equity-linked swaps. 2. Asset swaps ... Many investors use Asset Swaps to 'arbitrage' the credit markets, as in many ...

| PowerPoint PPT presentation | free to download

Section 7: How Are Proteins Made? (Translation) PowerPoint PPT Presentation

Section 7: How Are Proteins Made? (Translation) - Repeat the Denature, Anneal, Extension steps at their respective temperatures... Hybridization is also referred to as annealing or renaturation. May, 11, 2004. 49 ...

Repeat the Denature, Anneal, Extension steps at their respective temperatures... Hybridization is also referred to as annealing or renaturation. May, 11, 2004. 49 ...

| PowerPoint PPT presentation | free to view

Identification and Quantification of Polypeptide Similarity Tim PowerPoint PPT Presentation

Identification and Quantification of Polypeptide Similarity Tim - O. aries (domestic sheep) G. gallus (domestic fowl) 1.2Gb ... information is whole genome sequence from a related species, e.g. mouse for man ...

O. aries (domestic sheep) G. gallus (domestic fowl) 1.2Gb ... information is whole genome sequence from a related species, e.g. mouse for man ...

| PowerPoint PPT presentation | free to view

Diseo de primers PowerPoint PPT Presentation

Diseo de primers - Se busca secuenciar el gen en cuesti n. Regiones conservadas en genes hom logos de organismos cercanos ... 5'-termini less stable 3'-termini, which eliminates ...

Se busca secuenciar el gen en cuesti n. Regiones conservadas en genes hom logos de organismos cercanos ... 5'-termini less stable 3'-termini, which eliminates ...

| PowerPoint PPT presentation | free to view

20bp PowerPoint PPT Presentations