What are the potential control points

1
What are the potential control points of
organelle gene expression?
2
Organelle DNA copy number can regulate gene
expression
Cytoplasmic male sterility (CMS) in Phaseolus
vulgaris CMS maternally inherited failure to
produce or shed functional pollen (observed in
many species) Usually results from
gain-of-function mutations, novel genes that
arise in the plant mitochondrial genome via
recombination (many different CMS
genes). Phaseolus CMS gene (orf239) is on a
subgenomic molecule The nuclear fertility
restoration gene Fr depresses the copy number of
the orf239 subgenome, decreasing the accumulation
of orf239 transcripts and preventing the
expression of the male sterility trait (Mackenzie
and Chase Plant Cell 2905)
3
RNA Polymerases and promoters Polymerase Subuni
ts Consensus promoter ____________________________
__________________ Bacterial ??? and ?70
-35/-10 GTGTTGACA/TATAATG P
lastid encoded ??? and -35/-10 (PEP)
(nuclear-encoded ?s) TTGACA/TATAAT T7 s
ingle core overlaps initiation no ?
ATACGACTCACTATAGGGAGA Nuclear encoded single
core overlaps initiation plastid (NEP)
?specificity factor ATAGAAT A/G AA Nuclear
encoded single core overlaps initiation plant
mit ?specificity factor CRTA G/T
4
Identification of organelle transcript initiated
vs. processed 5 ends by in vitro capping and
RNase protection
Organelle transcripts are not capped with 7 Me-G
in vivo Initiated transcripts have 5 PP
or 5PPP termini and can be capped with guanylyl
transferase and 32p GTP in vitro (in contrast to
many transcripts that are processed from primary
transcripts) Radiolabeled transcripts are
then annealed to single-stranded DNA or RNA
overlapping the region of interest and digested
with a single-strand specific nuclease.
Double-stranded fragments are protected from
degradation and are subsequently sized on
denaturing gels The size of the protected
fragment defines the position of the 5 cap and
hence the transcript initiation site
5
Differential plastid gene expression based upon
recognition of distinct promoters by NEP and
PEP
(from Hajdukiewicz et al. EMBO J 164041-4048)
6
Differential plastid gene expression based upon
sigma subunits
from Lopez-Juez and Pyke Intl J Dev Biol 49557
7
Plant organelle RNA metabolism
Like prokaryotes, plant organelle genes are often
co-transcribed as operons In contrast to
prokaryotic transcripts, plant organelle
transcripts Are frequently processed to di or
mono-cistronic transcripts before
translation Frequently contain introns that must
be spliced prior to translation Must undergo an
RNA editing process to restore proper amino acid
coding
8
Plant organelle RNA processing
Polycistronic transcripts undergo extensive,
complex processing prior to translation e.g.
psbB operon in maize, encoding subunits of two
different plastid protein complexes psbB / psbH
/ petB / petD The nuclear mutation crp1 disrupts
processing of the polycistronic message and
consequently, PETB and PETD protein
accumulation Model Failure to accumulate
monocistronic petD transcripts results in failure
to translate petD Secondary structure models
indicate the petD initiation codon is buried in
secondary structure in the dicistronic petB /
petD transcript, but is free of secondary
structure in the monocistronic petD
transcript Failure to translate PETD may
destabilize PETB
9
High chlorophyll fluorescence (hcf) mutants
(maize and arabidopsis)
Mutants in the nuclear genes required for plastid
biogenesis and function Remember 14 of the
arabidopsis nuclear genome dedicated to plastid
function hcf/hcf gt pale-green, yellow, or
albino seedlings some fluoresce in the dark due
to dysfunctional photosystems hcf/hcf seedlings
are lethal, but in maize they grow large enough
for molecular analysis
from Jenkins et al. Plant Cell 9283
10
psbB operon processing in maize
(from Barkan et al. EMBOJ133170)
11
the crp1 mutant disrupts petB/petD processing and
PETD protein accumulation
(from Barkan et al. EMBOJ 133170)
12
Pentatricopeptide repeat (PPR) proteins Lurin et
al. Plant Cell 162089
One of the largest multigene families in plants
(441 members in arabidopsis vs 7 in
humans) Primarily plastid or mitochondrial
targeted Implicated in post-transcriptional RNA
metabolism through single gene/mutant analysis
e.g. crp1 locus in maize necessary for plastid
petB / petD RNA processing e. g.
restorer-of-fertility loci for CMS in petunia,
radish and rice all influence processing or
stability of mitochondrial CMS gene transcripts
and encode PPR proteins Why so many? (? RNA
editing) How do they function? (?RNA binding
adaptors that recruit enzymatic protein complexes
to act on RNA in a site-specific manner)
13
Pentatricopeptide repeat (PPR) proteins Lurin et
al. Plant Cell 162089
Figure 3. Motif Structure of Arabidopsis PPR
Proteins (35 amino acid repeats). Typical
structures of proteins from each of the principal
subfamilies and subgroups are shown. The
structures are purely indicative, and the number
and even order of repeats can vary in individual
proteins. The number of proteins falling into
each subgroup is shown.
14
Pentatricopeptide repeat (PPR) proteins Lurin et
al. Plant Cell 162089
We assume that the putative superhelix formed by
tandemly repeated PPR motifs forms a
sequence-specific RNA binding surface either
alone (A) or in the presence of an additional
factor (B). The resulting protein-RNA complex
recruits one or more other transfactors to a
specific site on the RNA target (in this case an
endonuclease). We assume that in most cases the
catalytic site is in the partner protein for the
DYW class of PPR proteins, it may lie in the
C-terminal domain itself.
15
Plant organelle introns
Group I and Group II, defined by characteristic
secondary structures and splicing mechanisms
From Gillham 1994 Organelle Genes and Genomes
16
Plant organelle introns
Group I and Group II have distinct splicing
mechansims Group II is the ancestor of the
nuclear intron and the characteristic groupII
intron domains the ancestors of the nuclear
splicosomal RNAs
From Gillham 1994 Organelle Genes and Genomes
17
Plant organelle introns
Land plant organelle introns primarily Group
II Characteristic spoke-and-wheel structure
necessary for splicing Some fungal versions are
self-splicing in vitro Trans-acting RNA and/or
protein factors required for splicing in
vivo e.g. maize nuclear mutants encoding
proteins required for splicing Genome
rearrangements have split introns, which then
require trans-splicing The spoke-and-wheel
structure is assembled from separate transcripts
18
The crs1 and crs2 mutants disrupt the splicing
of different group II introns (from Jenkins et
al. Plant Cell 9283)
atpF
intron
rps16
intron
19
Trans-splicing Chlamydomonas psaA transcripts
From Gillham 1994 Organelle Genes and Genomes
20
Plant organelle transcript stability
Plant organelle transcripts are stabilized by 3
stem-loop structures Removal of the stem loop
(by endonuclease cleavage) makes the 3 end
accessible for polyA addition In contrast to
nuclear transcripts, plant organelle transcripts
are destabilized by the addition of 3 poly A
tracts 3 polyA is also a de-stabilizing
feature of bacterial transcripts 3 polyA
enhances susceptibility of transcript to
degradation by exonucleases
21
Model for plastid mRNA turn-over (from Monde et
al. Biochimie 82573)
22
Plant organelle RNA editing

Post transcriptional C gt U and less frequently U
gt C genomic coding strand 5 ACG.....
unedited RNA 5 ACG.....
edited RNA 5 AUG....
edited cDNA 5
ATG..... Occurs by enzymatic trans-amination Occ
urs in plastids and plant mitochondria (more
frequently in mitochondria) Occurs primarily in
coding sequences and improves overall
conservation of predicted protein products
Creates initiation codons ACG gt AUG
Creates termination codons CGA gt UGA
Removes termination codons UGA gt CGA
Changes amino acid coding CCA gt CUA (P gt L)
Silent edits
ATC gt ATU Edit sites within the same gene vary
among species. An edit site in one species may
be pre-edited (ie correctly encoded) in the
genomic sequence of another species eg. plastid
psbL gene maize ATGACA.....
tobacco ACGACA.....
23
Plant organelle RNA editing
Every land plant lineage except Marchantiid
liverworts from Knoop (2004) Curr Genet
46123

Fig. 2 Several clades in the land plant phylogeny
identified and/or confirmed by molecular data as
monophyletic groups are A angiosperms, S seed
plants, M moniliformopses, E euphyllophytes, L
lycophytes, T tracheophytes. The monophyly of
gymnosperms (G) as a whole and that of a clade
comprising two of its classes, Gnetopsida and
Coniferopsida, is somewhat less well supported.
Likewise, more phylogenetic resolution is needed
for a clade comprising the eusporangiate ferns of
the order Marattiales, the horsetails
(Equisetales) and the leptosporangiate ferns vs a
clade comprising the Ophioglossales and whisk
ferns (Psilotales). The tree shown is
topologically consistent, albeit not always
statistically supported. Several phylogenetic
analyses of organelle genes (unpublished
observations) place hornworts (H) as sister group
to the tracheophytes (node Z), mosses (Ms) as a
sister group to the joint clade (Y) and confirm
marchantiid (ML) and jungermanniid (JL)
liverworts jointly as a sister group to all other
embryophytes (node X)
24
RNA editing improves conservation of the
predicted protein (from Mulligan and Maliga 1998)
25
RNA editing occurs by enzymatic deamination
from Rajasekhar and Mulligan Plant Cell 51843
from Russell, 1995, Genetics
26
Short 5 flanking sequences define editing
sites (from Mulligan and Maliga 1998)
27
RNA editing
Evidence for the importance of cis-guiding
sequences in plant mitochondrial RNA
editing Editing of recombinant or rearranged
mitochondrial genes Recombination breakpoint
immediately 3 to an editing site in rice atp6
did not abolish editing Recombination breakpoint
seven nucleotides 5 to an editing site in maize
rps12 did abolish editing Recombination
breakpoint 21 nucleotides 5 to an editing site
in maize rps12 did not abolish editing
Electroporation of genes into isolated
mitochondria, followed by isolation of
mitochondrial cDNA Editing of mutated coxII gene
demonstrated sequences from 16 to 6 required
for editing
28
RNA editing

• In vitro RNA editing system
• Substrate with 32P-C at editing site
• Incubate with chloroplast extract
• Digestion of substrate to mononucleotides
  separated by TLC

Fig. 1. In vitro RNA editing system.
(A) Synthesis of the psbL mRNA substrate labeled
at the editing site. The upstream RNA (150 nt
preceding the editing site with a 5' extension of
21 nt sequence from pBluescript II) and the
downstream RNA (10 nt downstream from the editing
site with the 3' extension of a 15 nt sequence
from the KS primer) are ligated with T4 DNA
ligase in the presence of a bridge DNA
oligonucleotide. Extensions are represented by
rectangular boxes. (B) Mg and K
dependencies of the in vitro editing reaction of
psbL mRNA. U, marker pU Ex, no chloroplast
extract. pU migrates slower than pC as indicated
by arrows.
from Hirose and Sugiura EMBOJ 51144
29
RNA editing
Evidence for the importance of trans-acting
factors Plastid in vitro RNA editing system
demonstrates competition among oligoribonucleotide
s for editing factors
Fig. 3. Competition analysis of in vitro RNA
editing. (A) Increasing amounts of upstream,
downstream and vector (vec) oligoribonucleotides
were added to in vitro editing reactions with
psbL mRNAs. pL5, pL3 and vec oligos of 1 µmol
(lanes 4, 7 and 10), 10 µmol (lanes 5, 8 and 11)
and 100 µmol (lanes 6, 9 and 12) were added.
U, authentic pU Ex, no chloroplast extract
0, no competitor. (B) Analysis with heterologous
competitors. nB5 (upstream of ndhB mRNA editing
site) (1, 10 and 100 µmol, lanes 7, 8 and 9,
respectively) was the heterologous competitior
for psbL mRNA.
from Hirose and Sugiura EMBOJ 51144
30
RNA editing genetic analysis defines a
trans-acting factor
Figure 1 Characterization of crr4 mutants. a,
Schematic model of NDH function. The NDH complex
functions in electron transport from the stromal
reducing pool, NADPH and reduced ferredoxin (Fd),
to the plastoquinone pool (PQ). PQ reduction in
the dark depends on NDH activity and is detected
in the transient rise of chlorophyll fluorescence
after illumination with actinic light (AL)6. PSI,
photosystem I PSII, photosystem II. b, Analysis
of the transient increase in chlorophyll
fluorescence after turning off AL. The bottom
curve indicates a typical trace of chlorophyll
fluorescence in the wild type (WT). Leaves were
exposed to AL (50 µmol photons m-2 s-1) for
5 min. AL was turned off and the subsequent
transient rise in fluorescence ascribed to NDH
activity was monitored by chlorophyll
fluorimetry. Insets are magnified traces from the
boxed area. crr4-X CRR4, crr4 alleles
transformed by the wild-type genomic CRR4
sequence. ML, measuring light SF, saturating
flash. c, Immunoblot analysis of thylakoid
proteins. Immunodetection of an NDH subunit
(NdhH) and photosystem II (PsbO). The lanes were
loaded with proteins corresponding to 0.5 µg of
chlorophyll for PsbO and tenfold the proteins for
NdhH (100) and a series of dilutions as
indicated.
from Kotera et al. Nature 433326
31
RNA editing genetic analysis identifies a
trans-acting factor
Figure 2 Structure of CRR4. a, Schematic
alignment of CRR4 and CRR2. The relationship
between PPR motifs (boxed) and PCMP motifs (bars
AH) is shown. PCMP motifs are labeled on the
basis of the original assignment10 except for the
E motif12. The sites of mutation in four crr4
alleles are indicated. White boxes are the
putative plastid targeting signals. The
C-terminal 15-amino-acid motif is indicated by a
bar labelled with an asterisk. b, Alignment of
eleven PPR motifs present in CRR4. Amino acids
conserved more than 60 are boxed in black.
Conserved similar amino acids are shaded. The
points of amino acid alteration in three alleles
are highlighted by red letters. A pair of
antiparallel -helixes, predicted from the
similarity with TPR motif11, is shown by
underlines.
from Kotera et al. Nature 433326
32
RNA editing genetic analysis identifies a
trans-acting factor
Figure 3 Analysis of RNA editing in the ndhD
initiation codon. a, Direct sequencing of RTPCR
products containing the ndhD initiation codon.
The psaC and ndhD region is shown schematically.
RNA editing sites are indicated. The restriction
enzyme NlaIII cleaves cDNA derived from edited
molecules. The editing site is so distal in the
transcripts that cDNA was sequenced on the
complementary strand. b, Semi-quantitative
analysis of the extent of RNA editing. RTPCR
products were digested with NlaIII. Fragments
originating from edited and unedited RNA
molecules are indicated. WT, wild type.
from Kotera et al. Nature 433326
33
Translation of organelle genes
A significant regulatory process in plastid gene
expression light-regulated chloroplast protein
accumulation increases 50-100 fold w/out changes
in mRNA accumulation 5 UTR is key in regulating
translation about ½ of plastid genes have a
Shine-Delgarno sequence (GGAG) homologous to
small subunit rRNA in this region nuclear-encoded
translation factors bind 5 untranslated region
(UTR) (and in some cases also the 3 UTR)
34
Translation of organelle genes
Regulation of plastid gene translation by
light (mediated by ?pH, ADP, redox
signals) Best-studied example is the translation
of PSII D1 (PSBA) protein in Chlamydomonas Accumu
lation of PSBA increased in light by
post-transcriptional regulation (ie no change in
steady-state level of mRNA) Site-directed
mutagenesis of psbA 5 UTR identified an SD
sequence and a stem-loop region as requirements
for translation A set of 4 major 5UTR binding
proteins was identified Binding increased 10X in
the light Protein reduction by thioredoxin
required for binding binding abolished by
oxidation of the binding proteins (Similar
complex seen in Arabidopsis) Binding to the 5
UTR was decreased following ADP-dependent
phosphorylation ADP accumulates in the dark
35
Translation of organelle genes
Redox regulation of PSBA protein synthesis in
Chlamydomonas
Fig. 4. Light-mediated redox control of
chloroplast psbA translation in Chlamydomonas. In
this model, a multiprotein complex consisting of
a 60 kDa protein with homology to protein
disulfide isomerases (PDI) 91, a 47 kDa protein
with homology to poly(A)-binding proteins (PABP)
92 and two unknown proteins of 38 kDa and
55 kDa, binds to the 5'-untranslated region of
the mature psbA transcript in Chlamydomonas. PABP
mediates the binding of the protein complex and
regulation of binding activity is mediated by
PDI. In the light, electrons from the
photosynthetic electron transport chain are
transferred via ferredoxin (Fd) and thioredoxin
(Trx) to a vicinal dithiol group of PDI. This
requires prior dithiol activation oxidation of
PDI by an unknown component. This component is
activated upon illumination by a priming' signal
starting from a reduced plastoquinone (PQ) pool
(PQH2) 26. In its reduced active form, PDI then
transmits its SH-group signal to PABP, resulting
in an increased binding activity that finally
leads to an increased translation of the message.
In the dark (grey box), PDI is inactivated via
phosphorylation by an ADP-dependent protein
kinase, which is activated by an increasing
ADPATP ratio in the dark and inactivated by the
decrease in the ADPATP ratio after illumination
27. Inactive protein complexes are shown in
dark green, active complexes in light green.
Abbreviations Cyt b6f, cytochrome b6f complex
e-, electrons Ox, unknown oxidizing activity P,
phosphoryl group PSI, photosystem I PSII,
photosystem II SS, disulfide bond.
from Pfannschmit Trends Plant Sci 833
36
Translation of organelle genes
Regulation of plastid protein synthesis by
presence or absence of assembly partners
Control by Epistasy of Synthesis (CES) In
transgenic tobacco, down-regulation of nuclear
encoded rbcS by antisense results in decreased
translation of rbcL Best-studied example is
Chlamydomonas plastid cytochrome f (b6f
complex) If other b6f subunits are not present,
cytochrome f cannot assemble Free (unassembled)
cytochrome f binds to its own (petA gene) 5 UTR
to down regulate translation
37
Functional analysis of plastid ycf6 in
transgenic plastids

• ycf6 knock-out lines
• Homoplasmic for aadA insertion into ycf6 via PCR
• Pale-yellow phenotype
• Normal PSI function and subunit accumulation
• Normal PSII function and subunit accumulation
• Abnormal b6f (PET) complex subunit accumulation
  (PETA)
• Purification and mass spectrometry analysis of
  normal plastid PET complex demonstrated a protein
  having the predicted mass of YCF6

Western blot analyses of thylakoid proteins from
three independent transplastomic ycf6 lines and a
dilution series of the wild type to test for the
presence of key components of the protein
complexes in the thylakoid membrane. Immunoblot
analyses with antibodies against AtpB (CF1
subunit), PsaC, the plastocyanin-docking protein
PsaF and the D1 and D2 proteins (PsbA and PsbD)
confirm the presence of wild-type levels of
chloroplast ATP synthase, PSI and PSII in ycf6
plants. Also, antibodies against the soluble
electron carrier plastocyanin (PetE) detect
similar levels of plastocyanin in extracted
lumenal proteins from the wild type and the
mutant. In contrast, immunoblots with
anti-cytochrome f (PetA) antibodies revealed
virtually a complete absence of cytochrome f
protein from all ycf6 lines, suggesting that the
mutants lack functional cytochrome b6f complex.
from Hager et al. (1999) EMBO J 185834
38
Organelle protein complex assembly and protein
turn-over
Failure to assemble a protein complex gtgtgt
degradation of unassembled subunits Assembly
dependent upon availability of all subunits and
co-factors Plastids contain several proteases
that are homologues of bacterial proteases In
bacteria and in fungal mitochondria, proteases
regulate gene expression by controlling levels of
key regulatory proteins
39
Bacterial type proteases in plastids
40
Organelle signaling Retrograde regulation
regulation of nuclear genes via organelle
signals Mitochondrial regulation of nuclear
genes NtAI (Nitotiana antimycin A induced) genes
Plastid regulation of nuclear gene
transcription through tetrapyrrole pathway
intermediates gun (genome uncoupled)
genes Plastid regulation of nuclear gene
transcription and translation through redox
signals Mitochondrial activation of programmed
cell death machinery
41
Mitochondrial regulation of plant nuclear genes
Plant mitochondrial respiratory electron transfer
chain includes an alternative pathway for
electron flow Single subunit alternative
oxidase (AOX) Encoded by a nuclear gene
(aox) Bypasses two of three sites for H
transfer coupled to ATP synthesis Transcription
of nuclear aox is upregulated when electron flow
through the cytochrome pathway is disrupted by
the inhibitor antimycin A (AA)
42
Mitochondrial regulation of plant nuclear genes
NtAI genes (Maxwell et al. Plant J
29267) Nuclear genes up-regulated in response
to AA, including aox Seven additional genes
identified by differential mRNA display, most
associated with stress responses acc
oxidase glutathione S transferase Sar8.2 cystein
e protease pathogen-induced lipase SA-induced
glucosyl transferase Also induced by reactive
oxygen species (ROS) (eg H2O2) Induction is
blocked by antioxidants such as flavones Of all
inducers, AA is the most rapid. This implicates
mitochondria as the site coordinating ROS
signaling in the plant cell
43
Mitochondrial regulation of plant nuclear genes
NtAI genes (Maxwell et al. Plant J 29267)
Figure 3.  Antioxidants lower intracellular ROS
levels and inhibit gene induction. (a) Effects
of antioxidant addition on AA, H2O2, and
SA-dependent accumulation of intracellular ROS in
tobacco suspension cells. ROS levels were
measured 4 h after AA (5 µm), H2O2 (5 mm) and SA
(1 mm) addition with and without preincubation
for 45 min with N-acetylcysteine (25 mm) or
flavone (1 mm). Data represent means SD for
three experiments. (b) Effect of the antioxidant
treatment described above on the AA-, H2O2-and
SA-dependent expression of Aox1 and the NtAI
genes.
44
Regulation of nuclear genes through plastid redox
signals
Figure 3. Summary of Redox Activities That
Control Gene Expression in Higher Plant Cells.
The PQ pool exerts control over both
chloroplastic and nuclear transcription. ROS, in
conjunction with the redox state of the PQ pool,
influences the expression of antioxidant defense
genes (e.g., APX genes). Cyt, cytochrome FD,
ferredoxin FNR, ferredoxin-NADP reductase PC,
plastocyanin QA and QB, primary and secondary
electron-accepting plastoquinones of PSII TD,
thioredoxin. from Surpin Plant Cell Supplement
2002S327
45
Regulation of nuclear genes through plastid redox
signals
Transcription of nuclear-encoded PSI subunits
PSAF and PSAD (Pfannschmidt et al. J Biol Chem
27636125) psaF and psaD promoters up-regulated
during acclimation from Light I to Light II A
plastid-to-nucleus redox signal is involved,
because DCMU, which inhibits reduction of PQ by
PSII, also inhibits psaF and psaD up-regulation
Fig. 4.   Effects of electron transport
inhibitors in interaction with PS-specific light
sources on PSI promoter activities. Growth
conditions and inhibitor treatments were as
indicated across the top. The identity of gene
promoters is given inside the panels. The
respective promoter activation of PSII light on
PSI plants (compare with Fig. 1, reduction
signal) was arbitrarily set to 100, and changes
in promoter utilization induced by switches
between light sources and inhibitor treatments
were expressed in percent. The values represent
the mean of three independent experiments
performed with 3-4 parallels.
46
Regulation of nuclear genes through plastid redox
signals
Translation of nuclear-encoded PSI subunits PSAF
and PSAD (Sherameti et al. Plant J 32631) __
psaF and psaD messages translated in light but
not dark __ DCMU inhibits light-induced
translation
Fig. 4.  Figure 1. Polyribosome profiles for the
spinach PsaD, PsaF and PsaL messages in etiolated
or light-grown spinach seedlings. (a) Absorption
(A254) and sucrose concentration profiles after
sucrose gradient centrifugation of a polysomal
fraction prepared from 7-day-old etiolated and
light-grown spinach seedlings. Approximately
100 µl fractions were collected from the
gradients and used for the measurements. (b)
Polyribosome profile of the spinach PsaD, PsaF
and PsaL messages in spinach seedlings, which
were kept in light or in darkness for 7 days
(light, darkness). Light  DCMU 12 h before
harvest the seedlings were sprayed with DCMU
(10 µm). After sucrose gradient centrifugations
and RNA extraction from the individual fractions
1 (top) to 9 (bottom), Northern hybridization was
performed with the respective cDNAs.
Representative of three independent experiments.
(c) As control, the polyribosome profile of the
tubulin gene is given.
47
Regulation of plastid transcription through
plastid redox signals
Photosynthetic control of chloroplast gene
expression (Pfannschmidt et al. Nature
397625) Complementary changes in transcription
rate and mRNA abundance for psaAB (photosystem I)
and psbA (photosystem II) during acclimation to
light I or light II
48
Regulation of plastid transcription through
plastid redox signals
Photosynthetic control of chloroplast gene
expression (Pfannschmidt et al. Nature
397625) Complementary changes in transcription
rate and mRNA abundance for psaAB (photosystem I)
and psbA (photosystem II) during acclimation to
light I or light II
49
Plastid regulation of nuclear genes through
tetrapyrrole pathway intermediates
gun (genome uncoupled) genes gun mutant
selection nuclear lhcb promoter down-regulated
when plastid development is disrupted with
norflurazon To identify mutants in which
this plastid-to-nucleus signal was disrupted,
Arabidopsis carrying two transgenes was
used lhcb promoter / gus lchb promoter /
hygromycin resistance Following mutagenesis,
screened for hygromycin resistance and gus
expression in the presence of norflurazon Identif
ied 5 loci, 4 have been cloned and all encode
proteins that function in tetrapyrrole
metabolism, strongly implicating tetrapyrroles in
plastid-to-nucleus signaling Pathway leads to
chlorophyll, heme, and phytochrome chromophore
50
Plastid regulation of nuclear genes through
tetrapyrrole pathway intermediates
5 steps
lt GUN4
lt
gt
---- lhcb
gt
from Surpin Plant Cell Supplement 2002S327
51
Multiple nuclear genes respond to plastid
tetrapyrrole signals
Figure 1 Microrarray analysis demonstrates that a
large number of nuclear encoded genes are
regulated by the plastid signal. a, Cluster
analysis of norflurazon-regulated genes induced
or repressed by at least three fold in gun1, gun2
and gun5 compared to wild type. Red colour
represents an increase in expression and blue
colour a decrease relative to wild type. b,
Classification of the genes that were not
repressed in gun2 and gun5 compared to wild type
when grown on norflurazon. From Strand et
al. Nature 42179