Invitrogen Corporation - PowerPoint PPT Presentation

1 / 1
About This Presentation
Title:

Invitrogen Corporation

Description:

miRNA Sequence Primers Relative Expression in Brain Relative Expression in Liver Let 7a UGAGGUAGUAGGUUGUAUAGUU Mir-124A HIGH Ct = 23.55 LOW Ct = 31.79 – PowerPoint PPT presentation

Number of Views:35
Avg rating:3.0/5.0
Slides: 2
Provided by: CB23
Category:

less

Transcript and Presenter's Notes

Title: Invitrogen Corporation


1
A Novel method to profile miRNA expression in
different organisms Sensitive and specific miRNA
qRT-PCR with the NCode SYBR Green miRNA qRT-PCR
Kit
Sam An, Mark Landers, Mason Brooks, Pete Joszi,
Ranjan J. Perera, and Christopher
Adams Invitrogen Corporation, Carlsbad California
Abstract
Figure 3 Closely Related miRNA Family
Discrimination
MicroRNAs (miRNAs) are short 22-24 nucleotide
RNAs that play a vital roles in regulating gene
expression. These single stranded RNA molecules
are incorporated into the RISC (RNA-inducing
silencing complex) and regulate gene expression
through various methods including translational
inhibition, transcriptional cleavage and
transcriptional gene silencing. Recent interest
in these non-coding RNAs has been explosive
because of its implication in cellular
differentiation and disease genesis. Therefore,
there is an urgent need to identify and validate
miRNA expression in cell lines, tissues, and
organs. qRT-PCR has become the standard for
microarray data validation, as well as an
invaluable tool for quantifying individual or
subsets of miRNAs with the greatest sensitivity
and accuracy. Most commercially available miRNA
qRT-PCR systems employ proprietary, pre-designed
miRNA-specific primers for cDNA synthesis by
reverse transcription. Unfortunately, this
approach requires that the sequence of the miRNA
is publicly available and a commercial qRT-PCR
assay has been developed for that specific
sequence, limiting the availability of qRT-PCR
assays for many model organisms as well as
recently discovered miRNAs or proprietary miRNAs.
Here, we describe a novel, universal, flexible
and user-friendly qRT-PCR method, that was
developed to measure and characterize miRNA
expression in almost all organisms, starting from
either total RNA and/or enriched miRNA. The
NCode miRNA SYBR Green qRT-PCR protocol is
based on carefully optimized polyadenylation
reaction with the reverse transcriptase,
SuperScript III RT, in a universal 1st strand
cDNA synthesis reaction.. The miRNA specific
amplification occurs during the PCR reaction
where the sequence of the miRNA of interest is
used as the target-specific PCR primer.
Platinum SYBR qPCR Supermix combines Platinum
Taq DNA polymerase with SYBR Green fluorescent
dye, delivers excellent sensitivity in the
quantification of target sequences. This
protocol offers 7 logs of dynamic range for
maximum sensitivity (detection down to 100
copies) and single nucleotide discrimination for
distinguishing between closely related miRNA
families.
Figure 1 NCodeTM miRNA qRT-PCR Overview
miRNA target
The NCode SYBR Green miRNA qRT-PCR Kit was used
to profile synthetic let-7a-e miRNA templates
from 100,000 copies using the let-7 A sequence as
the primer. Using the annealing temperature of
65C, the assay clearly discriminates the closely
related family members. The closest mismatch
(Let 7c) is approximately 10.5 CTs behind, which
correlates to over 1000 fold difference in
expression level.
Figure 4 Validation of Microarray Data Through
qRT-PCR
  • Highly Flexible System
  • Only 1 primer needed
  • No special probes
  • Quick assay design
  • Permits analysis of other small RNAs

Figure 2 Assay Performance (Dynamic
Range/Sensitivity)
Accuracy over a broad dynamic range of samples
Published microarray data was verified through
miRNA qRT-PCR. 4 pairs of miRNA primers, 2 of
which illustrated high expression level in either
brain or liver tissue were used to perform the
qPCR. The qPCR results correlated identically
with the microarray data, as exhibited by CT
values.
Summary
Slope -3.51 Y-int 38.12 R2 0.995
  • The NCodeTM miRNA qRT-PCR Assay offers
    unparalleled flexibility along
  • with a simple protocol to detect/quantitate
    miRNAs. No proprietary primers are
  • needed and can be used with any species on
    various small RNAs (incl. siRNAs,
  • snoRNAs, etc.)
  • The NCode miRNA qRT-PCR Assay provides 7 logs of
    dynamic range and
  • single nucleotide discrimination for maximum
    performance.

Amplification plot of a synthetic miRNA using the
NCode SYBR Green qRT-PCR Kit. The assay
exhibits a broad dynamic range up to seven logs
(100M to 100 copies) and shows an excellent
linear correlation between copy number and CT
value.
Invitrogen Corporation 1600 Faraday Ave.
Carlsbad, CA 92008 USA Tel 760 603 7200 FAX
760 602 6500 Toll Free Tel 800 955 6288
E-mail tech_service_at_invitrogen.com
www.invitrogen.com
Write a Comment
User Comments (0)
About PowerShow.com