Drosophila%20Population%20Genetics

1

Drosophila Population Genetics
Brian Charlesworth Institute of
Evolutionary Biology School of
Biological Sciences University of
Edinburgh
2
Why is intra-specific variability interesting?

• A high degree of variability is obviously
  favourable, as freely giving the materials for
  selection to work on Charles Darwin, The Origin
  of Species, Chap. 1.
• Darwin was the first person to recognize clearly
  that evolutionary change over time is the result
  of processes acting on genetically controlled
  variability among individuals within a
  population, which eventually cause differences
  between ancestral and descendant populations.
• Knowledge of the nature and causes of this
  variability is crucial for an understanding of
  the mechanisms of evolution, animal and plant
  breeding, and human genetic diseases.

3
Classical and quantitative genetic studies of
variation

• Classical genetics reveals the existence of
  discrete polymorphisms in natural populations,
  but is necessarily limited either to chromosomal
  rearrangements such as inversions that can be
  detected cytologically, or to conspicuous
  phenotypes such as eye colour or body colour
  (flies carrying certain eye-colour mutations such
  as cardinal can be found in natural populations).
  
• Within a given species, only a handful of such
  polymorphisms can easily be detected. Relatively
  few cases of discrete polymorphisms affecting
  morphological traits are known.

4
The classic polymorphism of Drosophila
pseudoobscura
A human inversion polymorphism
5

• Quantitative genetics reveals the existence of
  ubiquitous genetic variation in metrical and
  meristic traits.
• Most metric traits have a coefficient of
  variation (the ratio of the standard deviation to
  the mean) of 5-10.
• Measurements of the resemblances between
  relatives show that 20-80 of the variance in
  such traits is typically due to genetic factors.
• This type of variation is of great evolutionary,
  medical and economic significance, but measuring
  it does not tell us anything about the details of
  its genetic control (numbers of loci involved,
  frequencies of variant alleles, etc.).

6

• Studies of concealed variability (revealed by
  inbreeding) indicates the existence of low
  frequency recessive alleles usually with
  deleterious effects, that are not normally
  detectable in a large random-mating population.
• The results of close inbreeding (e.g. by
  brother-sister matings) are
• 1. Reduced mean performance of a set of inbred
  lines, with respect to traits like survival,
  fertility and growth rate.
• 2. Increased variability among lines,
  sometimes involving abnormalities caused by
  single gene mutations.

7

• While amply validating Darwins view that there
  is plenty of variation available for evolution to
  utilize, this evidence leaves two important
  questions unanswered
• How much variation within a natural population is
  there at an average locus? Classical genetics
  provides no means of sampling loci at random from
  the genome, without respect to their functional
  importance or level of natural variability.
• To what extent does natural selection as opposed
  to mutation and/or genetic drift control the
  frequencies of allelic variants within
  populations? The classical genetics bias towards
  genes with conspicuous phenotypic effects means
  that strong selective forces are likely to be
  operating. Such genes might well be
  unrepresentative of the global picture.

8
Molecular genetics to the rescue

• The solution to question (a) is to use the fact
  that genes correspond to stretches of DNA that
  code for proteins.
• If either the protein sequence corresponding to
  a gene, or its DNA sequence, can be studied
  directly, then we can look at variation within
  the population without having to follow visible
  mutations, i.e. there is no need for prior
  knowledge of the existence of variation.
• We can also look at variation in non-coding
  sequences.

9
Electrophoretic variation

• The first steps were taken in the mid-1960s by
  Lewontin and Hubby, working in Chicago on the
  fruitfly Drosophila pseudoobscura, and by Harris
  in London, working on humans.
• They used the technique of gel electrophoresis
  of proteins to screen populations for variants in
  a large number of soluble proteins controlled by
  independent loci, mostly enzymes with
  well-established metabolic roles. The proteins
  were chosen purely because they could be studied
  easily.

10

• The results of the early electrophoretic surveys
  were startling a large fraction (as high as 40)
  of loci were found to be polymorphic (i.e. they
  exhibited one or more minority alleles with
  frequencies greater than 1).
• An average D. pseudoobscura individual was
  estimated to be heterozygous at 13 of the 24
  protein loci that had been studied by 1974 i.e. a
  random individual sampled from the population
  would be expected to have distinct maternal and
  paternal alleles at 13 of its protein-coding
  loci.
• Much lower levels of heterozygosity (or gene
  diversity the chance that two randomly chosen
  copies of a gene are different) were found in
  mammals, and much higher levels in bacteria.

11

• This work conclusively refuted the view that
  loci are only rarely polymorphic.
• However, it raised more questions than it
  answered. In particular, there were several
  biases in the data. Only soluble proteins could
  easily be studied, and amino-acid changes that do
  not affect the mobility of proteins on gels are
  not detected by electrophoresis.
• Similarly, any changes in the DNA that do not
  affect the protein sequence go undetected.

12
DNA sequence variation

• The advent in the late 1970s of methods for
  cloning and sequencing of DNA meant that studies
  of natural variation could be carried out at the
  DNA level. This eliminates virtually all the
  possible biases in quantifying variability.
• With the advent of PCR amplification for
  isolated specific regions of the DNA, and with
  relatively cheap automated sequencing, this is
  now the method most commonly used in surveys of
  variation.
• Efforts are currently under way in D.
  melanogaster to scale this resequencing up to
  the whole genome level.

13

• The pioneering work on directly comparing
  homologous DNA sequences sampled within a species
  was carried out by Martin Kreitman in Lewontins
  lab at Harvard in the early 1980s.
• Kreitman sequenced 11 independent copies
  (alleles) of the Adh (alcohol dehydrogenase) gene
  of D. melanogaster, isolated from collections
  made around the world. He sequenced 2379 bases
  from each of these alleles, an heroic effort in
  those days.

14

• His work succeeded in
• Demonstrating a high level of variability at the
  level of individual nucleotide sites, a factor of
  ten or so higher than would have been expected
  from the typical level of heterozygosity for
  protein polymorphisms
• Showing that nearly all of this variability
  involved silent changes that did not affect
  protein sequences, i.e. the changes were either
  in regions that did not code for amino-acids or
  involved synonymous changes in codons.
• The only amino-acid polymorphism detected was
  that already known to cause the difference
  between the fast (F) and slow (S) electrophoretic
  alleles of Adh.

15
Kreitmans Adh Results

• Intron 1 Coding Region 3'
  Non-Transcr.
• Silent Sites
• Segregating 1.7 6.7
  0.6
• No. Sites 654 765
  767
• No non-silent substitutions found (other than
  F/S) 39 are expected if variability were same as
  for silent sites.

16

• These results demonstrate that the protein
  sequence is highly constrained by selection, i.e.
  most mutations affecting the amino-acid sequence
  of a protein cause selectively disadvantageous
  changes to its functioning, and are eliminated
  rapidly from the population.
• Most variation that is detected in coding
  sequences (typically over 85 in Drosophila) thus
  involves synonymous variants. Non-coding region
  variation shows a similar level to synonymous
  variation.
• These results suggest that most variation and
  evolution at the DNA level may be due to neutral
  or nearly neutral mutations, whose fate is
  controlled by genetic drift rather than
  selection, especially as much of the genome is
  non-coding, even in Drosophila.

17
How to measure DNA sequence variation
Allele 1
ATGCTTAGCGTTGGCATCCTAGCGATCGAG
Allele 2
ATGCTTGGCGTTGGCATCCTAGCGATCGG
Allele 3
ATACTTAGCGTTGGCATCCTCGCGATTGAG
18

• The nucleotide site diversity (?) for a given
  set of alleles sampled from a population is the
  frequency with which a randomly chosen pair of
  alleles differ at a given site.
• It can be calculated from data on a sample of
  homologous DNA sequences, by determining the sum
  of the numbers of differences between all
  possible pairs of sequences.
• The result is divided by the product of the
  number of sequences that were compared (this
  equals n(n-1)/2, if there are n independent
  alleles), and the number of bases studied.

19

• In the example, n 3, so n(n-1)/2 3.
• The total number of pairwise differences between
  all 3 combinations of sequences is 1 3 4 8.
  
• To get the pairwise diversity per site, we
  divide this by 3 times the number of sites, so
  that
• ? 8/(3 x 30) 0.089

20

• An alternative method of measuring variation is
  simply by counting the number of sites that are
  segregating in the sample, S.
• By dividing S by the product of the number of
  bases in the sequence and the sum
• a 1 1/2 1/3 ... 1/(n -1)
• we obtain a statistic called Wattersons ?w.

21

• If the population is at equilibrium and there is
  no selection, ? w is expected to be similar in
  value to ?.
• In the example, we have S 4, and a
  ?????????????????
• Hence
• ? w 4/(30 x 1.5) 0.089

22

• Under the neutral theory of evolution,
  variability in DNA sequences reflects the balance
  between the input of new variants by mutation and
  their loss by random fluctuations in frequencies
  caused by finite population size (genetic drift).

23

• Under this model, variant frequencies at a locus
  are always shifting around, but a statistical
  equilibrium will eventually be reached if
  population size stays constant.
• The expected value of the pairwise diversity in
  the population is then given by
• q 4Nem
• where m is the neutral mutation rate per site,
  and Ne is the effective population size, which
  controls the rate of genetic drift.
• The expected values of both p and ? w are equal
  to ?.

24

• Estimates of ? have now been obtained from many
  different kinds of organisms, by sampling sets of
  homologous genes from natural populations and
  sequencing them.
• Rough average values over many genes for silent
  nucleotide are as follows
• Escherichia coli (bacterium) 0.05
• Drosophila melanogaster 0.02
• (African)
• Homo sapiens 0.001

25

• Knowledge of m enables us to estimate Ne from q.
• For example, with m 4 x 10-9, and q 0.02, we
  obtain Ne 1.25 x 106.
• Drosophila effective population sizes are
  therefore very large.

26
Detecting Selection

• One of the major goals of evolutionary genetics
  is to understand to what extent selection, as
  opposed to neutral forces of mutation and genetic
  drift, controls variation and evolution in DNA
  and protein sequences.
• The methods for doing this often involves
  combining data on sequence divergence between
  species with data on polymorphism within species.

27
Forms of selection

• Purifying selection, which acts to prevent the
  spread of deleterious mutations, e.g. those
  affecting the amino-acid sequences of proteins.
• Positive directional selection, which causes an
  adaptive mutation to spread through a species
• Balancing selection, which maintains alternative
  variants in the population
• Directional and balancing selection are often
  collectively referred to as positive selection.

28

• Use of sequence divergence data
• The simplest situation is when we have two
  homologous (aligned) DNA sequences from a pair of
  related species.
• For the purpose of discussion, assume that all
  evolutionary change occurs by nucleotide
  substitutions, i.e. the sequence differences are
  caused entirely by one nucleotide base changing
  into another by mutation.
• This is usually the case for coding sequences,
  since insertions or deletions cause disruption of
  functionality.

29
The total time separating a pair of sequences
from the two species is 2T
30
Neutral sequence evolution

• Under neutral evolution, K is expected to be
  equal to the mutation rate (m) times the
  divergence time between the two species, i.e.
• K 2 m T
• The simplest way to understand this is to note
  that, under neutral evolution, the expected
  number of mutations that distinguish a pair of
  sequences is equal to the time separating them
  (2T) times the rate of mutation per unit time
  (m).

31

• We compare K values for nucleotide sites where
  mutations can reasonably be assumed to be neutral
  or nearly neutral with K for sites where we wish
  to test for selection larger than neutral K
  values indicate directional selection, and
  smaller than neutral K values indicate purifying
  selection.
• Nonsynonymous sites are usually used as the
  candidates for selection, but there is increasing
  use of defined types of non-coding sequences.

32
Evidence for pervasive purifying selection
This comes from the fact that both K and q for
nonsynonymous variants are nearly always
much smaller than for synonymous and noncoding
sites.
33
Statistics on diversity and divergence in D.
miranda (species 1 18 loci) and D.
pseudoobscura (species 2 14 loci)
All values are percentages Divergence (K) is
measured between D. miranda and D. affinis. (KS
between mir pseudo is 3.5) L. Loewe et al. 2006
Genetics 172 1079-1092.
34
Divergence of mel-sim introns
P. Haddrill et al. 2005 Genome Biol. 6 R67. 1-8.
35
Effects of deleterious mutations on fitness

• There are clearly a lot of deleterious mutations
  entering the population each generation, most of
  which will eventually be eliminated by selection
• While the mean level of variability is much lower
  for nonsynonymous than synonymous mutations, this
  could simply mean that all the deleterious ones
  are rapidly removed by selection, so that the
  amino-acid variants that we see segregating are
  in fact selectively neutral.

36

• It is a topic of current research to try and
  estimate the distribution of selection
  coefficients on deleterious amino-acid and silent
  variants in natural populations
• Estimate for amino-acid variants indicate a wide
  distribution, such that the mean selection
  coefficient against a heterozygous non-synonymous
  variant is of the order of 10-5
• Values for synonymous or silent variants are much
  smaller, of the order of 10-6.

37
Faster divergence in coding than non-coding
sequences suggests positive selection
Positive directional selection

• In the OdsH gene of three Drosophila species,
  divergence in the homeodomain is highly
  significantly accelerated
• This directly suggests selection

C. Ting et al. 1998 Science 2821501-1504
38
The McDonald-Kreitman test

• Compares non-synonymous and synonymous site
  divergence between species, and non-synonymous
  and synonymous site diversity within species, in
  the same gene
• If variants at both kinds of sites were neutral,
  the numbers of substitutions at the two kinds of
  sites between two species should be in the same
  ratio as the polymorphism within either species,
  assuming equilibrium between drift and mutation
• Neutral divergence 2Tm
• Neutral diversity 4Nem

39

• If the ratio of non-synonymous variants to
  synonymous variants for differences between
  species is greater than the ratio for
  within-species variation, this suggests positive
  directional selection
• If the opposite is the case, either purifying
  selection or balancing selection is acting

40
Centromeric histone protein evolution

• Alignment of the Cid proteins of five
  melanogaster subgroup species with histone H3
  proteins from D. melanogaster (2.3 million years
  divergence )with E. histolytica (gt 1 billion
  years divergence)
• The most divergent histone H3 sequences have gt75
  identity to each other, whereas centromeric
  H3-like proteins are much more diverged (3550
  identical to histone H3).

41
Sliding window analysis of Cid
50-nucleotide (nt) window, in steps of 10 nt,
using all sites
N-terminal tail region (mostly non-synonymous)
p or K
C-terminal core (mostly synonymous
substitutions)
intraspecific polymorphism within D. simulans (p)

interspecific divergence (K)
42
Evidence for adaptive evolution in D.
melanogaster simulans Cid

• Polymorphism was studied in D. melanogaster (15
  strains) and D. simulans (8 strains), and
  divergence between them
• Non-synonymous synonymous (NS) ratios differ
  significantly (P lt 0.0025)
• For divergence between the species 1810
• For pooled polymorphic sites within the two
  species 928
• McDonald-Kreitman test for the D. melanogaster
  lineage (box)
• P lt 0.006

H. Malik S. Henikoff 2001 Genetics 157
1293-1298
Fixed diffs Polymorphic sites
Non-syn 8 0
Synonymous 4 9
43

• Using data on many different genes, methods have
  been developed to use the McDonald-Kreitman
  approach to estimate what fraction of amino-acid
  differences between D. melanogaster and D.
  simulans are caused by directional selection.
• This fraction is of the order of 25, a
  surprisingly high value.
• N. Bierne A. Eyre-Walker 2004 Mol. Biol. Evol.
  21 1350-1360.

44
Indirect evidence for selection selective sweeps

• After an advantageous mutation has spread through
  a population, the level of polymorphism will be
  reduced across the region (i.e. at closely linked
  neutral sites)
• This is because a unique selectively favourable
  mutation may arise at a site in a DNA sequence
  that is completely linked to a polymorphic
  variant segregating in a population
• J. Maynard Smith J. Haigh 1974
  Genet. Res. 12 12-35.

45
A selective sweep fixes variants linked to the
selected siteIt is a form of hitch-hiking

• as the black (advantageous) variant increases in
  frequency in a population, it causes low
  diversity at closely linked sites in a sequence
  (white circles)

46
A recent selective sweep is detectable if the
time since selective substitution is sufficiently
small (around 0.25Ne generations), but there is a
lot of noise
47
Indirect evidence for selection statistics of
variant frequency distributions

• It is also possible to work out the frequencies
  at which variants are expected to be found in
  equilibrium populations, under both neutrality
  and selection
• Under neutrality, most variants are expected to
  be quite rare
• If selection is operating on the sequence, it
  will affect the frequencies of variants in the
  sample
• This forms the basis for some tests for
  selection, and methods for estimating the
  intensity of selection.

48

• Assuming neutrality and equilibrium, the expected
  value of both ? and ?w 4Nem
• If ? ? ? w, it suggests the possibility of
  selection
• If there are excess rare variants, compared with
  what is expected under neutrality, this suggests
  purifying selection
• Excess high frequency variants might suggest
  balancing selection or the presence of
  advantageous mutations spreading in the
  population
• BUT there are two problems
• We have to test whether the difference could be
  produced by chance
• The population may not have been constant in
  size, as assumed in the model, and so its
  demographic history may cause ? ? ? w

49
Statistical tests must be used!

• Things we estimate from a sample may look very
  different from the average that is expected
• Statistical tests are necessary to decide whether
  a sample could not have arisen by a process of
  neutral mutation and drift. Only if we can say
  this, can we conclude that something such as
  selection has affected the sequences.
• Neutrality is used as a null hypothesis

50
The spread of an advantageous mutation affects
diversity very much like a bottleneck, but only
on the region around the gene
Extreme bottleneck One haplotype present, then
new neutral variants occur ???lt ?w , negative
Tajimas D
Fixed advantageous mutation One haplotype
selected, then new neutral variants occur ???lt ?
w , Tajimas D lt 0
51
Evidence for a selective sweep on the neo-X
chromosome of D. miranda D. Bachtrog 2003 Nat.
Genet. 34 215-219.
52
Genome scans for selective sweeps

• There is currently a lot of interest in using
  scans of variability across the genome, to look
  for patterns that suggest a recent selective
  sweep.
• The hope is that this will lead to
  identification of the mutations that have been
  favoured by selection.

53

• One subject of study is non-African populations
  of D. melanogaster and D. simulans, which are
  believed to have originated relatively recently
  (10,000 years ago??) from ancestral African
  populations.
• They must have adapted to their new
  environments. It should be possible to see which
  regions of the genome show evidence of selective
  sweeps.
• The problem is that they have also gone through
  bottlenecks of small population size, which has
  similar effects to sweeps, but are distributed
  over the whole genome.

54
Relative values of microsatellite (A) and
sequence diversity (B) in non-African and
African populations of D. melanogaster
B. Harr et al. (2002) Proc. Natl. Acad. Sci. USA
99, 12949-12954
55
Scan of 250 approximately 500 bp non-coding
sequences across the X chromosome of mel (L.
Ometto et al. 2005 M.B.E. 22 2119-2130)
Q is the probability of getting as many as the
observed number of polymorphisms in the European
sample on a bottleneck model Empty and filled
circles indicate sig. negative or positive
Tajimas D.
56

• Some recent research problems in my lab
• What is the typical magnitude of selection on
  mutations that alter codon usage?
• Are non-coding sequences evolving neutrally?

57

• The genetic code is degenerate there are at
  least two codons for each amino-acid except
  methionine and tryptophan
• The 3rd coding position is often redundant, so
  that at least some changes in it frequently
  result in no change in the protein sequence

58

• The genetic code is degenerate there are at
  least two codons for each amino-acid except
  methionine and tryptophan
• The 3rd coding position is often redundant, so
  that at least some changes in it frequently
  result in no change in the protein sequence

59

• It might be thought that synonymous changes would
  have no effect on fitness, so that such changes
  could be treated as selectively neutral
• If this is so, the frequency with which codons
  corresponding to a particular amino-acid are used
  should correspond to the frequencies with which
  they would be expected to be produced by randomly
  combining their constituent nucleotides
• It quickly became apparent in the early days of
  DNA sequencing that this was not the case, and
  that there is considerable codon usage bias in
  many species

60

• The proportion of codons in a gene that are
  preferred (major codons) provides an index of
  overall codon bias (major codon usage or MCU)
• A variant of this method has become popular with
  the advent of databases of levels of gene
  expression to identify codons that are more
  frequently used in genes with high levels of
  expression
• These are often called optimal codons, and the
  frequency of optimal codons in a gene is known as
  Fop. This term is now often used for MCU

61

• An important observation is that there is a
  general tendency for patterns of codon usage to
  be fairly consistent across different genes in
  the genome i.e. the same codons are preferred in
  different genes, although the level of bias
  varies considerably, and there are differences
  between species in the nature of the preferred
  codons
• General levels of codon usage are well-conserved
  evolutionarily

62
(No Transcript)
63

• These facts suggest that the forces affecting
  the use of preferred codons mainly operate across
  the whole genome, rather than being specific for
  individual genes, although the magnitude of these
  forces varies considerably.

64
The evolution of codon usage bias

• In most species there is substantial variation at
  synonymous nucleotide sites, even in genes with
  high levels of codon usage bias (of the order of
  1-2 per cent diversity per site in many
  Drosophila species)
• This means that any selection on codon usage must
  be weak in relation to other evolutionary
  factors, such as genetic drift and mutation.
• In order to understand codon bias, we need
  population genetic models that take all three
  factors into account

65
Modelling codon usage evolution(the Li-Bulmer
model)

• The simplest model that can be made is for a
  random-mating population with a large number of
  independently evolving sites
• Each site has two alternatives preferred and
  unpreferred codons (A versus a)

66
Evolutionary forces

• Selection for preferred over unpreferred codons
• Mutation in either direction (preferred to
  unpreferred, and vice-versa).
• Genetic drift (random sampling of allele
  frequencies). Its effectiveness is inversely
  related to the effective population size (Ne )

67

• Selection is less effective at preventing
  deleterious mutations becoming polymorphic than
  spreading to fixation.
• It was suggested in 1995 by Hiroshi Akashi that
  this result could be used to test for present-day
  selection on codon usage
• This requires a species in which synonymous
  single nucleotide polymorphisms at numerous
  codons exist, and in which the ancestral state of
  each SNP can be inferred

68

• Polymorphic mutations can then be classified as
  preferred (P) to unpreferred (U)
• In addition, we need to identify fixed
  differences from a related species as P ??U or U
  ? P, to check whether codon bias is in
  evolutionary equilibrium.
• These differences are assumed to have
  accumulated in the two focal species since the
  split between them

69

• If codon usage is in equilibrium, the numbers of
  fixations in the two directions must be equal
• Since selection has less of an effect on
  polymorphic mutations than fixations, we thus
  expect a deficiency of U ? P polymorphisms, and
  an excess of P ??U polymorphisms
• Mutational bias and mutation rates do not affect
  these statistics, if codon usage is in
  equilibrium

70
The species of choice

• We have been using three Drosophila species for
  this purpose
• D. miranda is used for the polymorphism study
• D. pseudoobscura is a very close relative (less
  than 4 silent site divergence from miranda)
• D. affinis is a more distant outgroup species
  (about 23 silent site divergence from the other
  two)
• Codons were classified as preferred (P) versus
  unpreferred (U), using Akashis codon usage
  table for D. pseudoobscura.

71
(No Transcript)
72
(No Transcript)
73
(No Transcript)
74
(No Transcript)
75
(No Transcript)
76
(No Transcript)
77
Polymorphism/divergence for codon usage changes
for 18 X and autosomal genes

• P ??U U ??P
• Fixed 19 12
• Polymorphic 37 6
• rpd 1.95 0.50
• Ratio of rpd values 3.9

C. Bartolomé et al. 2005 Genetics 169 1495-1507
78

• For a sample of n homologous sequences from the
  population, the expected fraction of P ? U
  polymorphisms among both P ? U and U ??P
  polymorphisms is
• ? upI0/(up I0 v1-p I1)
• where
• I0 is the probability that a P ? U
  polymorphism is detected in the sample
• I1 is the probability of detecting a U ? P
  polymorphism
• p is the proportion of P codons in the
  sequence
• u and v are the mutation rates for P ? U and U
  ? P changes

79
(No Transcript)
80

• If the Li-Bulmer formula for equilibrium p is
  substituted into this equation, we get the simple
  relation
• ? I0 /(I0 I1e - ? )
• i.e. the proportion of P ??U polymorphisms
  depends only on ?? 4Net.
• This allows us to use maximum likelihood to
  estimate the value of ? and its approximate 95
  confidence limits.

81

• For all 18 genes together, the maximum likelihood
  of ? was 2.5 (2-unit support limits 1.5 - 3.8.
• This value is not significantly different from
  those obtained after dividing the dataset into
  two groups of genes with low bias (Fop lt 0.60, ?
  2.6) and high bias (Fop gt 0.63, ? 2.2).
• This lack of an apparent difference may reflect
  the limited range of Fop values the average
  Fopvalues for the low and high bias groups were
  0.50 0.024 and 0.66 0.009, respectively.

82

• These results suggest that Net for mutations
  changing codon usage in D. miranda is between
  0.38 to 0.96, with an ML value of 0.62
• Silent polymorphism data suggest an Ne of about
  800,000 for miranda. The selection coefficient s
  is thus about 8 x 10-7
• This is much lower than previous estimates of Net
  by Akashi and coworkers for simulans and
  pseudoobscura (around 1 or more)
• It agrees well with an estimate using the same
  approach for americana

83
GC to AT changes
84

• Similar methods to those applied to P and U
  codons can be applied to GC content at 3rd coding
  positions (GC3) to explain the observed mean
  value of 69 with the estimated level of
  selection requires a mutational bias of over
  3-fold in favour of GC to AT mutations
• This predicts a GC content of 23 for non-coding
  sequences, if these are evolving neutrally, as
  opposed to an observed value of around 36
• The implication is that non-coding sequences are
  subject to non-neutral evolution, despite our
  failure to detect it.

85
Formation of a neo-Y chromosome
86

• The two autosomal copies in males segregate with
  the sex chromosomes in the first division of
  meiosis, in such a way that one always
  accompanies the X into a sperm, and the other
  accompanies the Y.
• The lack of crossing over in male Drosophila
  means that the neo-Y chromosome is immediately
  placed in a genetic environment that is identical
  to that of the true Y chromosome.

87
(No Transcript)
88
From Bachtrog Charlesworth (2002) Nature 416
323-326.
89
Relaxed selection on codon usage

• Fixations were assigned to the neo-X and neo-Y
  branches, subsequent to the neo-X/neo-Y split
• Neo-X Neo-Y
• P ? U 15 47 p 0.014
• U ? P 7 4

Bartolomé and Charlesworth 2006 Genetics
1742033-2044
90
Polymorphisms on the neo-X versus the neo-Y

• On a Mantel-Haenszel test, there is a
  significant excess (p lt0.001) of non-synonymous
  relative to silent polymorphisms on the neo-Y
  compared with the neo-X, indicating a relaxation
  of purifying selection on the neo-Y.

91
ACKNOWLEDGEMENTS

• THE HARD EXPERIMENTAL WORK Doris Bachtrog,
  Carolina Bartolomé, and Soojin Yi
• HELP WITH FLY-COLLECTING Deborah Charlesworth
• PROVISION OF LAB FACILITIES ON COLLECTING TRIP
  Dan Barbash, Chuck Langley
• IDENTIFICATION OF MIRANDA STRAINS Doris Bachtrog
• TECHNICAL ASSISTANCE Helen Borthwick and Helen
  Cowan
• MONEY BBSRC, Royal Society
• THEODOSIUS DOBZHANSKY for discovering D. miranda
  71 years ago, and for the posthumous loan of his
  field microscope