Title: DNA
1 DNA
2- DNA
- must carry information
- must be replicatable (inheritance)
- must be changeable (mutation)
3DNA
4DNA structure
deoxyribonucleic acid - two directional
polynucleotide strands in a double helix
5two directional polynucleotide strands in double
helix
start with a ribose sugar
6two directional polynucleotide strands in double
helix
start with a ribose sugar
remove an oxygen at carbon 2.
7two directional polynucleotide strands in double
helix
start with a ribose sugar
remove an oxygen at carbon 2.
add a phosphate group at 5 side add a
nitrogenous base at 1 side a nucleotide
8two directional polynucleotide strands in double
helix
9Bases purines (adenine, guanine) and
pyrimidines (cytosine, thymine)
10two directional polynucleotide strands in double
helix
nucleotides are linked in chains with a
phosphodiester bond free ends of chain will have
5 phosphate at one end, 3 hydroxyl at the
other end
5 end
phosphodiester bond
3 end
11two directional polynucleotide strands in double
helix
nucleotides are linked in chains with a
phosphodiester bond free ends of chain will have
5 phosphate at one end, 3 hydroxyl at the
other end
5 end
3 end
12two directional polynucleotide strands in double
helix
Two strands pair up, nucleotides linked with
hydrogen bonds adenosine pairs with
thymine cytosine pairs with guanine
13two directional polynucleotide strands in double
helix
Two strands pair up, nucleotides linked with
hydrogen bonds adenosine pairs with
thymine cytosine pairs with guanine -
abbreviated as base pairs
14two directional polynucleotide strands in double
helix
15two directional polynucleotide strands in double
helix
Strands have polarity - 5'-hydroxyl group of
first nucleotide at one end,
3'-hydroxyl group at other end (5 to 3
strand) Strands run antiparallel (5' -gt
3') ATGGAATTCTCGCTC (3' lt- 5')
TACCTTAAGAGCGAG
16DNA replication two strands are both
available as templates for new strand result
is doubling (2 complete new double helices)
17An historical digression..
18DNA replication always occurs in 5
to 3 direction is semiconservative
19DNA replication always occurs in 5
to 3 direction is semiconservative
occurs at multiple replication forks along the
DNA strand
20DNA replication always occurs in 5
to 3 direction is semiconservative
occurs at multiple replication forks along the
DNA strand
21DNA replication a. formation of short RNA
primers b. DNA polymerase adds nucleotides to 3'
end c. leading strand proceeds linearly
lagging strand proceeds with Okasaki fragments e.
RNAase removes the primers f. DNA polymerase
fills in the resulting gaps g. final gap is
closed by ligase.
22another digression.
23some additional points there are several
DNA polymerases involved in replication DNA
polymerases have a proof-reading and editing
function (exonulease activity)
24 TRANSCRIPTION
25Consider
if all DNA was used, most mutations would be
lethal there would be no raw material for
evolutionary change what would happen to genes
de-activated by mutation? In fact, many errors
and duplications leave extra DNA If there is
excess DNA, it may be - only between genes -
also interspersed within genes
26Consider
Not all gene products are required
simultaneously needs for proteins change or
differ - during development (e.g., milk
digesting enzymes) - over time (e.g. digestive
enzymes) - among organs (e.g. liver enzymes not
in muscle) therefore regulation of gene
activity is needed
27Transcription
Uses RNA as an intermediary - to assemble
genes - to transmit the right information
when/where it is needed (regulation)
28Transcription
Uses RNA as an intermediary - to assemble
genes - to transmit the right information
when/where it is needed (regulation)
RNA is ribonucleic acid - has uracil instead of
thymine - sugar is ribose instead of deoxyribose
29There are three types of RNA mRNA messenger
RNA carries the code for a gene rRNA
ribosomal RNA used to construct ribosomes tRNA
transfer RNA short adapters to carry amino
acid and its anti-codon
30- DNA strand (double, helical) - permanent
- (5' -gt 3') ATGGAATTCTCGCTC (coding, sense
strand) - (3' lt- 5') TACCTTAAGAGCGAG (template, antisense
strand)
31- DNA strand (double, helical) - permanent
- (5' -gt 3') ATGGAATTCTCGCTC (coding, sense
strand) - (3' lt- 5') TACCTTAAGAGCGAG (template, antisense
strand) - mRNA strand (single, linear) temporary, as
needed - (5' -gt 3') AUGGAAUUCUCGCUC (from template
strand) -
32- DNA strand (double, helical) - permanent
- (5' -gt 3') ATGGAATTCTCGCTC (coding, sense
strand) - (3' lt- 5') TACCTTAAGAGCGAG (template, antisense
strand) - mRNA strand (single, linear) temporary, as
needed - (5' -gt 3') AUGGAAUUCUCGCUC (from template
strand) - note by taking information from the template
(antisense) strand - of DNA, mRNA becomes the coding
sequence
33- DNA strand (double, helical) - permanent
- (5' -gt 3') ATGGAATTCTCGCTC (coding, sense
strand) - (3' lt- 5') TACCTTAAGAGCGAG (template, antisense
strand) - mRNA strand (single, linear) temporary, as
needed - (5' -gt 3') AUGGAAUUCUCGCUC (from template
strand) - protein sequence (single, with 1?, 2?, 3?, 4?
structure) - Met-Glu-Phe-Ser-Leu...
34Gene structure
promoter region immediately upstream (5 end) of
its gene contains TATAAA and TTGACA or CCAAT
codes enhancer region (only eukaryotes) may be
anywhere
35Steps in transcription 1. initiation RNA
polymerase recognizes and binds to promoter
sequence - these contain TATAAA and
TTGACA or CCAAT codes - in eukaryotes,
transcription factors recognize enhancer and
promoter sequences
36Steps in transcription 1. initiation RNA
polymerase recognizes and binds to promoter
sequence - these contain TATAAA and
TTGACA or CCAAT codes - in eukaryotes,
transcription factors recognize enhancer and
promoter sequences 2. elongation -
similar to DNA replication - only one
strand (template) is used
37Steps in transcription 1. initiation RNA
polymerase recognizes and binds to promoter
sequence - these contain TATAAA and
TTGACA or CCAAT codes - in eukaryotes,
transcription factors recognize enhancer and
promoter sequences 2. elongation -
similar to DNA replication - only one
strand (template) is used 3. termination
- transcription keeps going for 1000-2000 bases
beyond end of gene
38After transcription RNA processing capping -
methylated guanine nucleotide added at 5 end
- allows recognition by ribosomes for
translation polyadenylation - 3 end
recognized by AAUAA sequence - RNA cleaved
downstream - string of 200 adenines
added intron removal - spliceosomes used to
cleave RNA and excise introns
39 TRANSLATION The Genetic Code
40The genetic code
DNA and RNA have 4 types of bases proteins are
composed of amino acids, of which there are 20
- so how do 4 bases encode 20 amino acids?
41The genetic code
words with two bases allow 16 combinations
(42) words with three bases allow 64
combinations (43)
42The genetic code
- composed of nucleotide triplets (codons)
mRNA AUG GAA UUC UCG CUC
protein sequence Met Glu Phe
Ser Leu
43The genetic code
- composed of nucleotide triplets (codons)
- non-overlapping
mRNA AUG GAA UUC UCG CUC
protein sequence Met Glu Phe
Ser Leu NOT
AUGGAAUUCUCGCUC
44The genetic code
- composed of nucleotide triplets (codons)
- non-overlapping
- unambiguous each codon only specifies one
amino acid - degenerate most amino acids specified by
several codons
45second position
third position
first position
46Reading frame must be uniquely specified thered
foxatethehotdog t her edf oxa tet heh otd
og th ere dfo xat eth eho tdo g the red fox
ate the hot dog
What tells the reader where to start?
47 start codon
48Reading frame must be uniquely specified mRNA
code begins with start codon (AUG) protein is
constructed along open reading frame translation
stops at stop codon (UAA, UAG, or UGA) (only in
frame sequence out of frame does not work)
49Reading frame must be uniquely specified mRNA
code begins with start codon (AUG) protein is
constructed along open reading frame translation
stops at stop codon (UAA, UAG, or UGA) (only in
frame sequence out of frame does not work)
50The genetic code
- composed of nucleotide triplets (codons)
- non-overlapping
- unambiguous
- degenerate
- nearly universal except for portions of
mitrochondrial DNA and a few
procaryotes
51 TRANSLATION assembling proteins
52Three types of RNA mRNA messenger RNA
carries the code for a gene
5
3
GUCCCGUGAUGCCGAGUUGGAGUAGAUAACCU
53Three types of RNA mRNA messenger RNA
carries the code for a gene rRNA ribosomal RNA
used to construct ribosomes - four
types, used to make two-unit ribsome
(30 S)
(60 S)
54Three types of RNA mRNA messenger RNA
carries the code for a gene rRNA ribosomal RNA
used to construct ribosomes tRNA transfer
RNA short adapters to carry amino acid
and its anti-codon
anticodon
55Steps in translation 1. initiation
ribosomal subunits recognize, bind to 5 cap on
mRNA initiator tRNA (with UAC anticodon)
binds to AUG start codon
56Steps in translation 1. initiation 2.
elongation next tRNA pairs with its codon
peptidyl transferase 1. catalyzes formation
of peptide bond between amino acids
57Steps in translation 1. initiation 2.
elongation next tRNA pairs with its codon
peptidyl transferase 1. catalyzes formation
of peptide bond between amino acids 2. breaks
amino acid bond with previous tRNA ribosome
shifts over one codon
58Steps in translation 1. initiation 2.
elongation 3. termination stop codon is
recognized, bound to by release factor,
polypeptide is freed
59Protein structure primary amino acid
sequence secondary helix or pleated sheet, held
with hydrogen bonds tertiary collapsed molecule
with internal bonds quaternary protein subunits
combine to form functional protein