Ribosomal RNA promoters are very strong

1
Ribosomal RNA promoters are very strong
Fig. 6.7
The A-tracts bend the DNA
Usually -7 or -8
16 bp
The shorter spacer and extra distance between the
-10 region and 1 help RNAP leave the promoter
rapidly, thus allowing a new RNAP to bind
Fis is a DNA-binding protein that also bends DNA
2
The C-terminal domain of the alpha subunits
contact the UP element
Fig 6.26
3
The alpha subunit footprints the UP element
between -40 and -60
Template strand
Non-template strand
Holoenzyme footprint
Alpha does not footprint at promoters that lack
an UP element
Fig. 6.25
4
Mutations in the C-terminal domain of alpha
prevent UP element recognition
Constitutive RNA from plasmid (level of
transcription control)
5
When RNAP stalls, transcription can be restarted
with the help of factors that that convert RNAP
into a nuclease to cleave the nascent transcript.
A narrow domain of the factor inserts through the
rNTP channel to reach the active site of RNAP
Acidic residues on the protein coordinate the
RNAP Mg ion and a water molecule to stimulate
intrinsic nucleolytic activity of RNAP.
TFIIS Fig. 11.29
Transcription arrest may occur after Misincorpora
tion of the wrong rNMP that does not base-pair
with the template DNA RNAP pausing because of a
defect or extensive 2 structure in the template
DNA or To stimulate promoter escape by
suppressing release of abortive transcripts
6
Catalytic activities of RNAP
7
Termination at intrinsic (factor-independent)
terminators
Fig. 6.46
All terminators cause transcriptional pausing
prior to termination but not all pause sites
cause termination
Intrinsic terminators invariably contain a
potential hairpin in the upstream RNA
Termination occurs at a string of U residues
(minimum of 3)
By no means ALL hairpins, including some that
have 2-3 U residues following, are genuine
terminators
Terminators have different efficiencies Some may
only halt a minority or 50 of RNAP
molecules Others may halt gt90, some even 99
8
Mechanism of transcription termination
Yarnell, Roberts. Science 1999
9
Fig. 6.47
Yarnell, Roberts. Science 1999
Bead - dsDNA
oligos
1. Transcribe DNA oligo to mutant terminator,
rNTP 2. Separate template DNA-RNA-RNAP complex
(P) from released RNA (S) Analyze after agarose
gel e/ø
oligo t18
No oligo
oligo t19
10
Fig. 6.51
Hairpins are not essential for termination when
Rho factor can function
Rho is an RNA helicase that moves 5-gt3 along
the RNA. If it can load onto an RNA and catch up
with RNAP it can destabilize the RNAP-RNA binding
domain leading to release of the RNA
Rho normally terminates transcription in
non-coding regions. Rho is prevented from causing
termination within coding regions of transcripts
by ribosomes, which are translating the nascent
RNA.
If a mRNA contains a mutation that causes
premature termination of translation, Rho can
cause premature transcription termination. If the
normal mRNA is polycistronic, Rho can prevent
downstream genes from being transcribed (and thus
translated), even if those genes are themselves
wild-type. This phenotype is called
transcriptional polarity a mutation in an
upstream gene prevents transcription of
downstream genes.
11
Hairpin loops are also used in attenuation of
gene expression
Attenuation is a common form of control in amino
acid biosynthetic operons
Fig. 7.27
12
Fig. 7.28
13
Fig. 7.32
14
Diauxic growth of E. coli on glucose lactose
15
The lac promoter is weak and requires the
positively-acting factor CAP cAMP to form an
open complex for initiation
16
The C-terminal domain of alpha interacts with
CAP-cAMP, increasing promoter strength by 14-fold
Fig. 7.20
The lacUV5 mutant promoter does not require
CAP-cAMP
17
Lac
CAP-cAMP site centered at -61
Lac (mutant)
CAP-cAMP site moved, centered at -51, -61, -72,
-103 (spaced by one helical turn)
Gal P1
CAP-cAMP site centered at -40.5, binding overlaps
-35 region
Busby and Ebright J. Mol. Biol. 293199-213
(1999)
18
Crystal structure of a DNACAP-cAMP complex.
Crystal structure of a DNACAP-cAMP?-CTD complex.
Fig. 7.17
The DNA helix is bent 94 by a CAP-cAMP dimer
binding to the two-fold symmetrical 22 bp
DNA. 5-AAATGTGATCTAGATCACATTT
TTTACACTAGATCTAGTGTAAA
The CAP-cAMP binding site was extended
symmetrically with DNA having high affinity for
?-CTD. Two molecules of ?-CTD bind to each site,
one is in contact with both DNA and CAP, the
other with DNA only
19
Lambda repressor acts as a transcriptional
activator at the PRM promoter by contacting the
sigma subunit of RNAP
Fig. 8.325
20
The tetrameric lac repressor binds to the
operator, a sequence with dyad symmetry, to
prevent RNAP from transcribing
Fig. 7.3
21
Fig. 7.3