Transcription and Posttranscriptional Processing

1
Chapter 16 Transcription and
Posttranscriptional Processing The term
transcription in molecular biology means RNA
biosynthesis.
2
In 1955 Francis Crick hypothesized that there
were intermediate molecules which participated
in trans- ferring genetic information from DNA
to protein. The intermediate molecule was
RNA. In 1958 he put forth the famous central
dogma. ---? --? DNA--------?
RNA------? protein ?--------
Temin 1970
3
In 1961 the DNA dependent RNA polymerase was
discovered in E coli and the study on the
mechanism of transcription began. In 1982
Thomas Cech discovered that one of the precursor
RNA in Tetrahymena chould act as a catalyst and
catalyzed self-splicing. It is a ribozyme.
4
Section
1 DNA dependent RNA
synthesis RNA synthesis is catalyzed by DDRP (
or simply RNA polymerase. )
5
Characteristics of RNA
synthesis Template DNA ( one strand DNA in
dsDNA, template strand ) Substrate four
kinds of NTP Enzyme DDRP ( no reqirement
of primer, no proof-reading
function ) Direction of RNA chain 5 to
3 synthesis Base pairing GC TA AU rule
Inorganic Mg Zn ion
6
The process of transcription can be divided
into three stages initiation, elongation and
termination. see the fig. on the
blackboard
7
The two strands in dsDNA are complementary. They
are the coding strand and the template
strand. The template strand works as the
template for the synthesis of RNA. The
synthesized RNA is complementary to the template
strand. Its sequence is the same as
that of the coding strand with the exception of
the substitution of U for T.
8
eg. 5 CGCATTAACG 3 coding strand
3 GCGTAATTGC 5 template
strand 5 CGCAUUAACG 3 RNA
transcript The
Reaction ( NMP )n NTP ----------? ( NMP
)n1 PPi
9
Asymmetric
Transcription ----?----?-------?
----------------? _______________________________
_________________ ________________________________
________________
?----------
?----------- In dsDNA one strand is coding
strand. It is not transcribed. The other strand
is template strand. It is transcribed. In a
segment of dsDNA the coding information of genes
may be in different strands.
10
RNA
polymerase There is only one type of RNA pol in
prokaryotes while there are three types of RNA
pols in eukaryotes.
E coli RNA polymerase E coli RNA pol catalyzes
synthesis of all the RNAs ( mRNA , rRNA , tRNA
etc )
11
Structure of E coli RNA
polymerase The holoenzyme of E coli RNA pol
contains a2ßß(?)s subunits The s subunit can
be dissociated from the holoenzyme. The RNA pol
without s subunit is called core enzyme a2ßß(?)
12
Function of the Subunit s
can recognize promoters and initiate
transcription. a can bind regulatory proteins
and control the transcriptional .
rate. ßß catalyzes RNA synthesis. There may
be ? subunit. Its function is unknown. There are
different kinds of s subunits. The most common
one is s70.
13
Eukaryotic RNA
polymerases RNA pol I
RNA pol II RNA pol III _____________________
_______________________________ Product
45SrRNA hnRNA tRNA synthesized
( precursor ( precursor 5SrRNA
precursors of 18S, 28S
of mRNA) snRNA 5.8S
rRNAs) ___________________________________________
_________ Sensitivity to
no high
intermediate a-amanite __________________________
__________________________
14
Structure of Eukaryotic
RNA pols Each type of eukaryotic RNA pols
contains two different large subunits and ten
odd small subunits. The largest subunit of RNA
pol II contains consensus sequence at the
carboxyl terminal called CTD. CTD is composed of
several dozens of heptad ( YSPTSPS ) repeats.
15
CTD
Function RNA pol II with the unphosphorylated
CTD participates in the beginning of
transcriptional initiation. During the process
of intiation many Ser and some Tyr residues of
CTD are phosphorylated. RNA pol II with the
phosphorylated CTD fulfills the initia- tion and
leaves the promoter. RNA synthesis enters in the
stage of elongation.
16
Prokaryotic
Transcriptional Initiation Prokaryotic RNA pol
binds the promoter and initiates transcrip-
tion. Promoter DNA sequence that is usually
upstream of a genes coding sequence and that
RNA pol binds and initiates transcrip- tion.
s subunit can recognize the
promoter E coli promoters extend from 70 to 30
of the initiation site (1)
17
Most of them have two regions of consensus
sequence , the -35 region ( TTGACA ) and the -10
region ( Pribnow box TATAAT ). s70 can
recognize the consensus sequence. Some promoters
of genes with high transcriptional rate have
another consensus region , the AT-rich up-element
(-40 to -60 ) which a subunit binds. The
holoenzyme of RNA pol binds the promoter via s
subunit.
18
strong promoter / weak
promoter It is the -35 and -10 regions and the
distance between them and the distance between
10 region and the transcriptionnal initiation
site , that determines the transcriptional
rate. The more similar the 35 and 10 regions
of a promoter to the consensus sequences of
TTGACA and TATAAT , the stronger affinity it has
for RNA pol binding. That results in the higher
transcriptional rate. And vice versa.
19
Process of Prokaryotic Trancriptional
Initiation RNA pol recognizes and binds the
promoter. That forms a close transcription
complex. DNA double helix near 10 region
unwinds. That results in an open transcription
complex. Transcription begins. A triple-element
complex of DNA, RNA pol and the newly synthesized
RNA forms The formation of the triple-element
complex causes con- formation change.
20
RNA pol leaves the promoter and elongation
begins. As the elongation begins the s subunit
dissociates from RNA pol. It is the core enzyme
of RNA pol that is responsible for the
elongation.
21
Eukaryotic Transcriptional
Initiation Eukaryotic RNA pols alone can not
initiate transcription. Only with the help of
transcription factors can they fulfill the task
of initiation. Transcriptional initiation of RNA
pol II needs not only the enzyme but also
multiple transcription factors.
22
There are consensus sequences in many of the RNA
pol II recognized promoters. They are 30
region ( TATA box ) and 1 region ( the ini-
tiation site , initiator , Inr ). The initiation
stage of RNA pol II can be divided into two
steps the assembly step and the initiation
step.
23
The Assembly
Step TBP ( TATA-binding protein ) binds TATA
box. TFIIB ( or with TFIIA ) binds TBP and
promoter. With the help of TFIIF , RNA pol II-
TFIIF complex inter- actes with TFIIB and binds
TFIIB and promoter. Then TFIIE and TFIIH join
them. RNA pol II and the TFII factors form a
close initiation com- plex on the promoter.
24
The Initiation
Step TFIIH has both the helicase and the kinase
activities. It unwinds dsDNA. The close
initiation complex becomes the open initiation
com- plex. TFIIH also catalyzes phosphorylation
of CTD. RNA pol II with phosphorylated CTD
initiates transcription.
25
The Initiation Stage of RNA pol I or
RNA pol III The initiation stage of RNA pol I or
RNA pol III is similar to that of RNA pol
II. The transcription factors recognize and bind
the promoter. RNA pol I or RNA pol III joins
them to form an initiation complex. Initiation
begins.
26
Initiation Stage of RNA
pol I rDNA ( contains genes of 18 S rRNA, 28 S
rRNA and 5.8 S rRNA ) is transcribed by RNA pol
I. The product is 45SrRNA There are two
consensus sequences in rDNA promoter core
element ( 1 region ) and UCE ( upstream control
element ). Transcription factor UBF binds UCE
first. Then transcription factor SL1 binds core
element. RNA pol I joins them. They form a
complex on promoter. Initiation begins.
27
RNA pol III initiates transcription of 5SrRNA
gene or tRNA gene. There are internal promoters
in such genes. Internal promoter means the
promoter within the coding region of the gene.
tRNA genes promoter has two consensus sequences
A box and B box, while 5SrRNA genes promoter
has only one con- sensus sequence C box.
28
Transcriptional Initiation of
5SrRNA Gene TFIIIA binds C box. TFIIIC and
TFIIIB bind TFIIIA. RNA pol III binds them. A
complex is formed. RNA pol III initiates
transcription.
29
Initiation RNA pol I RNA pol
III RNA pol II ______________________________
____________________ ATP requirement no
no
yes ______________________________________________
____
A and B or TATA box core consensus
sq. core element C box Inr
_________________________________________________
_
CAAT box upstream
element UCE
GC box etc _____________________________________
_____________ general TFs SL1
TFIIIA B C various TFIIs ______________
_____________________________________ upstream
factors UBF
various up-

stream factors ___________________________________
__________________
30
Transcriptional
Termination There are two types of
transcriptional termination in prokaryotes ?
independent and ? dependent.
? independent termination There are two
characteristics of ? independent termination
sq. ( terminator ). A segment of GC-rich ,
self-complementary sq. It is followed by a
series of T. eg
GCCGCCAGTTCGGCTTGCCGCCTTTT
31
The RNA synthesized is also self-complementary
and forms a stem-loop structure followed by
aseries of U.
U U
5 GCCGCCAG C CGGCGGUC
U U GG
U U U
3 RNA pol interacts with the structure and
stops at the template The UA pairs are unstable.
The newly synthesized RNA re- leases from the
template. Transcription terminates.
32
? dependent
termination The terminator of the ? dependent
termination is not typical. It contains CA-rich
region which ? factor can recognize. ? factor
is a homo-hexamer protein factor , can bind the
newly synthesized RNA and moves to the RNA-DNA
hybrid region. ? factor has helicase activity
and unwinds the RNA-DNA helix depending on the
energy released from ATP hydrolysis.
33
Section 2 Posttranscriptional
Processing Mature eukaryotic mRNA has
experienced 5- and 3 end processing and
splicing. hnRNA ( or mRNA ) is
capped at 5 end Most hnRNA have a cap of
7-methylguanosine triphosphate ( m7Gppp-) at the
5 end. It is added to the 5 end of the growing
transcript of 25-30 nucleotides via 55
triphosphate linkage. The cap protects hnRNA (
and mRNA ) from Rnase attack and participates in
the binding of mRNA and ribosome.
34
hnRNA ( or mRNA ) has a poly A tail
at the 3end Almost all of eukaryotic hnRNAs (
or mRNAs ) have a poly A tail of 80-250
nucleotides at the 3end. It is enzymatically
added to the primary transcript intwo stages.

Cleavage The transcript is cleaved 10 to 30
nucleotides past a highly conserved AAUAAA sq (
the polyadenylation signal sq ) and within 50
nucleotides before a GU-rich sq.
35
10-30nts lt
50nts -----------AAUAAA----------------I----------
---------GU-rich
cleavage site
Polyadenylation The poly A tail is
subsequently generated from ATP through
stepwise action of poly A polymerase. Multiple
enzymes and protein factors participate in the
two stages.
36

Splicing. Split Gene ,
Exon and Intron Eukaryotic genes consist of
alternating coding and non- coding sequences. In
other words the coding sq of eu- karyotic genes
is not continuous. They are split genes. The
coding sq in the split gene is called the exon,
the non-coding sq, the intron.
37
hnRNA is co-linear to its template DNA except
the cap and the tail. It also contains
alternating exons and introns. The coding sq of
mRNA is continuous. hnRNA following excision of
introns and connection of exons becomes mRNA.
This process is called splicing.
38
The Mechanism of
Splicing There are consensus sequences at the
junctions of exon and intron . They are
called splice sites. The shortest splice sites
at the 5 end ( splice donor ) and 3 end (
splice acceptor ) of the intron are GU and AG
respec- tively. Upstream of AG there is a
branch point A . exon 1
intron exon
2 GU-----------------------A-----AG
splice donor branch
point splice acceptor
39
The branch point A initiates nucleophilic attack
at the 5end of the intron. It is the first
transesterification reaction.
?------------------ GU-----------------A
-------AG Exon1 is released. Intron
forms a lariat.
-----G OH
-----A------AG
40
The 3end of exon 1 initiates nucleophilic attack
at the 3 end of the intron. It is the second
transesterification reaction.
OH gt
G
-----A------AG Exon1 and exon2
are connected. Lariat form of intron is re-
leased. Splicing is completed.

G
-----A------AG
41
The previously described splicing takes place in
the spliceosome. Spliceosome contains snRNPs
which are composed of snRNAs and
proteins. snRNAs in snRNPs are U-rich, and
called URNAs. There are 5 URNAs. .The process
of splicing in the spliceosome includes spliceo-
some assembly, spliceosome activation and splicing
42
An eukaryotic gene may direct transcription of
different hnRNAs from different promoters or
using different poly- adenylation sites. There
are two promoters in glucokinase gene. In the
liver cell transcription initiates from the
second pro- moter which is near the coding sq,
while in the pancreatic ß cell transcription
initiates from the first promoter which is
upstream located. This is an example that one
gene can express different hnRNAs ( and mRNAs
).
43
In the different developmental stages of
lymphocyte B 3 end processing of the hnRNA of µ
chain can use dif- ferent polyadenylation sites
and yield different hnRNAS ( and mRNA ) This is
another example. Alternative
Splicing Provides for Different
mRNAs from the Same hnRNA The mechanism of
alternative splicing includes the selective
inclusion or exclusion of exons, the use of
alternative 5do- nor or 3 acceptor sites.
44
exon1 exon2
exon3 ------------------
hnRNA splicing1 (mRNA1)
splicing2 (mRNA2) exon1 exon2
exon2 exon3

splicing3 (mRNA3)
exson1 exon2 exon3

45

hnRNA -------------------
2 donor sites in exon1
2 acceptor sites in exon3
3mRNAs
exon 123
part of exon 1e2e3
e1e2 part of exon 3
46
rRNA precursor processing requires Rnases
prokaryotic 30SrRNA precursor----?
methylation ----? Rnases cut ----?
precursors of 23SrRNA, 16SrRNA 5SrRNA
and tRNA----? Rnases cut ----? 23SrRNA
16SrRNA , 5SrRNA and tRNA
47
eukaryotic 45SrRNA precursor----?methylation
-----?snoRNP mediated processing----?precur
sors of 18SrRNA , 28SrRNA , 5.8SrRNA
----?snoRNP mediated processing ----?
18SrRNA , 28SrRNA , 5.8SrRNA
48
tRNA precursor
processing tRNA precursor processing in
prokaryotes and eukaryotes are similar. It
includes 5end cutting 3end
cutting and CCA adding (if there isnt CCA)
splicing (if there is intron ,
splicing takes place via
enzymatic cutting and joining)
base modification.
49
Self-splicing Catalyzed
by RNA In 1982 T. Cech discovered that the
intronof Tetrahymena rRNA precursor could
catalyzed self-splicing. The intron that can
catalyze self-splicing belongs to the group I
intron. Group I intron catalyzes self-splicing
with the help of cofactor guanosine or guanosine
phosphate
50
The self-splicing includes two transesterfication
reactions 5---------------------
3 exon 1
exon
2 5----------------------
3 G-OH? G-OH attacks
the first nucleotide at the 5end of the
intron. Exon 1 is released. 5OH
G------------------
--3
51
Exon 1s 3end attacks the nucleotide at the 3
end of the intron.
G----------------3
5OH? Two exons are connected.
The intron is released. 5
3
G---------------OH
52
There are group II introns , which can also
catalyze self- splicing. They catalyze
self-splicing just like the previously mentioned
lariat-form splicing. It also includes two
transesterification reactions but does not take
place in spliceosome and does not require any
cofactor. Group I and group II introns are
ribozymes.
53
Some mRNAs Undergo
Editing Coding information can be changed at the
mRNA level by RNA editing. In such cases the
coding sq of the mRNA differs from that in the
cognat DNA. RNA editing is discovered first in
protozoan and mediated by g-RNA.
54
Some nucleotides can be changed in or added into
or deleted from the mRNA coding sq by RNA
editing. That results in change of the genetic
codon and / or the reading frame of the coding
sq. The expressed protein is changed.
55
An example of human RNA editing is the
apolipoprotein B mRNA. In liver the single apoB
gene is transcribed into an mRNA that directs
the synthesis of a 100 Kda protein . In the
intestine the same gene directs the synthesis of
the primary transcript however acytidine
deamination converts a CAA codon in the mRNA to
UAA at a single specific site. Rather than
encoding glutamine this codon becomes stop
codon and a 48 Kda protein is the result.
56
Section 3 RNA dependent RNA
synthesis RNA as
genetic material All plant viruses, several
bacteriophages and many animal viruses have
genomes consisting of RNA. There are three types
of RNA genomes dsRNA, ssRNA and two copies of
the same ssRNA. The dsRNA and ssRNA are
replicated by RNA replicase ( RNA dependent RNA
polymerase, RDRP ).
57
In most cases RNA genome is single
stranded. There are two subtypes of ssRNA
genomes the ssRNA and the ssRNA. ssRNA
genome functions both as genetic material and
mRNA, while ssRNA genome serves only as genetic
material. Viruses with ssRNA genomes use the
ssRNA as a template for the synthesis of a
complement strand , which can then serve as
template in replicating the original strand.
58
Retroviruses have two copies of the same ssRNA as
the genome. They carry the reverse
transcriptase. It has three enzymatic activities
RDDP , DDDP and Rnase H