Revised%20Syllabus - PowerPoint PPT Presentation

About This Presentation

Title:

Revised%20Syllabus

Description:

Revised Syllabus. What's. Left. Exam III Coverage. General Concepts; ... Chapter 8, Assigned Readings; Sugar, Man vs. Chimps, Pheromones. Exam II. Mean = 74 ... – PowerPoint PPT presentation

Number of Views:47

Avg rating:3.0/5.0

Slides: 9

Provided by: jeffy8

Learn more at: https://fire.biol.wwu.edu

Category:

Tags: 20syllabus | pheromones | revised

Transcript and Presenter's Notes

Title: Revised%20Syllabus

1
Revised Syllabus
Whats Left
2
Exam III Coverage

General Concepts
Intro Biology - 321 Exam II,
PCR,
Chapter 8,
Assigned Readings
Sugar, Man vs. Chimps, Pheromones

3
Exam II

Mean 74
130
120
110
100
90
80
70
60
50
40

4
1353
5
MREC .GDEY
6
MREC .GDEY
AUGCGUGAAUCUGGUGAUGAAUAU
7
(No Transcript)
8
1353
ATGCGTGAATGT
ATATTCATCACC
1353
introns

Write a Comment

User Comments (0)

About PowerShow.com

Recommended Relevance Latest Highest Rated Most Viewed

Sort by:

Related More from user

CrystalGraphics Presentations

Introducing-PowerShowcom PowerPoint PPT Presentation

Introducing-PowerShowcom - Introducing-PowerShowcom (Without Music)

CrystalGraphics 3D Character Slides for PowerPoint PowerPoint PPT Presentation

CrystalGraphics 3D Character Slides for PowerPoint - CrystalGraphics 3D Character Slides for PowerPoint

Chart and Diagram Slides for PowerPoint PowerPoint PPT Presentation

Chart and Diagram Slides for PowerPoint - Beautifully designed chart and diagram s for PowerPoint with visually stunning graphics and animation effects. Our new CrystalGraphics Chart and Diagram Slides for PowerPoint is a collection of over 1000 impressively designed data-driven chart and editable diagram s guaranteed to impress any audience. They are all artistically enhanced with visually stunning color, shadow and lighting effects. Many of them are also animated. And they’re ready for you to use in your PowerPoint presentations the moment you need them. – PowerPoint PPT presentation

Related Presentations

UCP 600 Revisions Uniform Customs and Practice for Documentary Credits A Seminar on the UCP 600 and PowerPoint PPT Presentation

UCP 600 Revisions Uniform Customs and Practice for Documentary Credits A Seminar on the UCP 600 and - Article 9: Advising of Credits and Amendments. Article 10: Amendments. ... Summary: The UCP 600 revisions. Simplifies the overall structure of the UCP Articles. ... | PowerPoint PPT presentation | free to view

Alignment of 21st Century Skills, the Virginia MATH SOL, Revised Blooms Taxonomy and Researchbased I PowerPoint PPT Presentation

Alignment of 21st Century Skills, the Virginia MATH SOL, Revised Blooms Taxonomy and Researchbased I - Revised Bloom's Taxonomy and Research-based Instructional/Assessment Strategies ... of the Standards of Learning with the cognitive domains of Bloom's Taxonomy. ... | PowerPoint PPT presentation | free to view

Drafting and Revising Academic Writing PowerPoint PPT Presentation

Drafting and Revising Academic Writing - To help you develop a greater sensitivity to audience in ... Revised: After reaching northern Alaska or the Arctic Islands, the swans breed in the lowlands. ... | PowerPoint PPT presentation | free to view

to the 2006 Revised Social Studies Framework PowerPoint PPT Presentation

to the 2006 Revised Social Studies Framework - Introduce the newly revised Social Studies Framework for grades K-8 and high school courses ... Arkansas History must be taught in each grade, K-6. ... | PowerPoint PPT presentation | free to view

Processes and Policy for Revising Monthly Production Statistics (GDP) at Statistics Canada PowerPoint PPT Presentation

Processes and Policy for Revising Monthly Production Statistics (GDP) at Statistics Canada - ... adjusted data are normally revised over a 3-month period ... Methodologies compiled for specific period of time. Database can be decomposed into 4 categories: ... | PowerPoint PPT presentation | free to view

Recent work on revisions in the UK PowerPoint PPT Presentation

Recent work on revisions in the UK - Noise' debate. Linking revised and historical series. Why are we concerned with ... Two schools of thought on this: sometimes called the News v. Noise debate ... | PowerPoint PPT presentation | free to view

Revising Bankart Protocols: PowerPoint PPT Presentation

Revising Bankart Protocols: - Revising Bankart Protocols: | PowerPoint PPT presentation | free to view

The revised standards for HLTA status PowerPoint PPT Presentation

The revised standards for HLTA status - Clearer standards but not easier. Initial feedback has been positive. I feel the revised standards are much clearer than the current ones and it will ... | PowerPoint PPT presentation | free to view

ISIC Revision 4: Toptop Structure for reporting data by activity: What are national accounting needs PowerPoint PPT Presentation

ISIC Revision 4: Toptop Structure for reporting data by activity: What are national accounting needs - Eurostat proposal for an aggregation structure of revised ISIC and NACE ... GHI. F. 3. Construction. F. B, C, D and E. 2. Industry, including energy & waste management ... | PowerPoint PPT presentation | free to view

A Revised U'S' National Vegetation Classification Standard: Progress and Next Steps PowerPoint PPT Presentation

A Revised U'S' National Vegetation Classification Standard: Progress and Next Steps - A Revised U'S' National Vegetation Classification Standard: Progress and Next Steps | PowerPoint PPT presentation | free to view

AS15 REVISED 2005 EMPLOYEES BENEFITS PowerPoint PPT Presentation

AS15 REVISED 2005 EMPLOYEES BENEFITS - Provident Fund - Medical Facilities. AS 15(Revised 2005- Employee's Benefit) ... e.g. Provident Fund. - On Retirement Employee gets : Accumulated. Contribution and ... | PowerPoint PPT presentation | free to view

Simplex Method- Revise part-1 PowerPoint PPT Presentation

Simplex Method- Revise part-1 - Revise simplex method, part of optimization in Engineering. Specially designed for Engineering students of BPUT | PowerPoint PPT presentation | free to view

Revised Schedule VI PowerPoint PPT Presentation

Revised Schedule VI - Revised Schedule VI By: CA Kamal Garg [FCA, DISA (ICAI), LLB, MBA] cakamalgarg@gmail.com, 9811054015 Introduction Old Schedule VI had outlived its utility; Revised ... | PowerPoint PPT presentation | free to view

Revised IRR of National Building Code PowerPoint PPT Presentation

Revised IRR of National Building Code - Professional Regulatory Board of Architecture (PRBoA) Anotations on the PRBoCE Powerpoint Presentation Featured in the PICE website Revised IRR of National Building ... | PowerPoint PPT presentation | free to view

Proposed Recommendations for Guidelines Revisions PowerPoint PPT Presentation

Proposed Recommendations for Guidelines Revisions - Proposed Recommendations for Guidelines Revisions Proposed Recommendations At its September meeting, the Commission considered proposals for possible revisions to the ... | PowerPoint PPT presentation | free to view

Making Sense of the Math Revisions PowerPoint PPT Presentation

Making Sense of the Math Revisions - Making Sense of the Math Revisions George W. Bright, Ph.D. Special Assistant to the Superintendent OSPI George.Bright@k12.wa.us | PowerPoint PPT presentation | free to view

HSM 270 Week 6 CheckPoint Revised Evaluation Plan PowerPoint PPT Presentation

HSM 270 Week 6 CheckPoint Revised Evaluation Plan - HSM 270 Week 6 CheckPoint Revised Evaluation Plan | PowerPoint PPT presentation | free to view

Optimal revision of uncertain estimates in project portfolio selection PowerPoint PPT Presentation

Optimal revision of uncertain estimates in project portfolio selection - Optimal revision of uncertain estimates in project portfolio selection Eeva Vilkkumaa, Juuso Liesi , Ahti Salo Department of Mathematics and Systems Analysis, | PowerPoint PPT presentation | free to view

Exploring the Impact of the Revised Math Standards PowerPoint PPT Presentation

Exploring the Impact of the Revised Math Standards - Exploring the Impact of the Revised Math Standards Lexie Domaradzki Assistant Superintendent Teaching & Learning Office of Superintendent of Public Instruction | PowerPoint PPT presentation | free to view

New GST Revised Rates For 40 Items PowerPoint PPT Presentation

New GST Revised Rates For 40 Items - The GST Helpline is the best way to acquire knowledge about GST revised rates for all items. Get more details about GST rates, Download GST Helpline app. Which available both supports iOS and Android platforms at:- https://play.google.com/store/apps/details?id=com.gsthelpline&hl=en | PowerPoint PPT presentation | free to view

CY 2023 Revised Guidelines for Office Visits PowerPoint PPT Presentation

CY 2023 Revised Guidelines for Office Visits - To discuss revised guidelines for office visits, we shared definitions of, new and established patients; initial and subsequent services; and services reported separately. | PowerPoint PPT presentation | free to view

PDF_⚡ Revising and Editing for Translators: Fourth edition (Translation Practices PowerPoint PPT Presentation

PDF_⚡ Revising and Editing for Translators: Fourth edition (Translation Practices - COPY LINK HERE ; good.readbooks.link/pwshow/1138895164 $PDF$/READ/DOWNLOAD Revising and Editing for Translators: Fourth edition (Translation Practices Explained) | Revising and Editing for Translators provides guidance and learning materials for translation students and professional translators learning to revise the work of others or edit original writing, and those wishing to improve their self-revision ability. Revising and edit | PowerPoint PPT presentation | free to view

[PDF] DOWNLOAD Harry Potter Golden Snitch Kit (Revised and Upgraded): PowerPoint PPT Presentation

[PDF] DOWNLOAD Harry Potter Golden Snitch Kit (Revised and Upgraded): - 20 minutes ago - COPY LINK TO DOWNLOAD = flip.ebookmarket.pro/psjul24/0762482427 | PDF/READ Harry Potter Golden Snitch Kit (Revised and Upgraded): Revised Edition (RP Minis) | This authentic collectible features a gold-plated Golden Snitch as seen in the Harry Potter films with detachable wings and includes a handsome wooden display stand. A mini book featuring information about Quidditch and the Golden Snitch with quotes and full-color images from the movies completes the set! This officially licensed replica of the Golden Snitch is the perfect must-have collectible for fans of the Wizarding World! Harry Potter: Hedwig Owl Figurine: With Sound! Harry Potter Time-Turner Kit (Revised, All-Metal Construction) Harry Potter Levitating Golden Snitch Harry Potter: Hogwarts Trunk | PowerPoint PPT presentation | free to view

(PDF) Healing ADD Revised Edition: The Breakthrough Program that Allows You to See and Heal the 7 Types of ADD Free PowerPoint PPT Presentation

(PDF) Healing ADD Revised Edition: The Breakthrough Program that Allows You to See and Heal the 7 Types of ADD Free - "Copy Link : gooread.fileunlimited.club/pwjul24/0425269973 Healing ADD Revised Edition: The Breakthrough Program that Allows You to See and Heal the 7 Types of ADD A revised edition of the New York Times bestseller that will help you conquer ADD8212from the author of The End of Mental Illness. Attention deficit disorder (ADD) is a national health crisis that continues to grow8212yet it remains one of the most misunderstood and incorrectly treated illnesses today. Neuropsychiatrist Daniel G. Amen, MD was one of the first to identify that there are multiple types beyond just purely hyperactive or inattentive ADD, each requiring a different treatment. Now, in this all-new, revised edition, Dr. Amen again employs the latest medical advances in the field, including the largest brain imaging study ever completed on patients with ADD, to identify, examine, and demystify the 7 distinct types of ADD and their specific treatments. With up" | PowerPoint PPT presentation | free to view

(PDF) GED Test Prep Plus 2024-2025: Includes 2 Full Length Practice Tests, 1000+ Practice Questions, and 60+ Online Videos (Kaplan Test Prep) Revised, Revised Edition Android PowerPoint PPT Presentation

(PDF) GED Test Prep Plus 2024-2025: Includes 2 Full Length Practice Tests, 1000+ Practice Questions, and 60+ Online Videos (Kaplan Test Prep) Revised, Revised Edition Android - "Copy Link : gooread.fileunlimited.club/pwjul24/1506290442 GED Test Prep Plus 2024-2025: Includes 2 Full Length Practice Tests, 1000+ Practice Questions, and 60+ Online Videos (Kaplan Test Prep) Revised, Revised Edition Rated Best of the Best in GED Prep Books by BestReviewsWith realistic practice, proven strategies, and expert guidance, Kaplan's GED Test Prep Plus 2024â€“2025 (English edition, US exam) gives you everything you need to pass the test - including 60+ online videos to provide expert guidance.Â Kaplan is the official partner for live online prep for the GED test, and our GED study guide is 100% aligned with the GED test objectives.Kaplanâ€™s GED Prep Plus 2024-2025 covers all subjects and is designed for self-study so you can prep at your own pace, on your own schedule. Weâ€™re so confident that GED Test Prep Plus 2024â€“2025 offers the guidance you need that we guarantee it: After studying with our book, you'll pas" | PowerPoint PPT presentation | free to view

Download Pediatric Primary Care: Well-Child Care (Revised) (Core Handbook Pediatrics) Revised ed. Edition Free PowerPoint PPT Presentation

Download Pediatric Primary Care: Well-Child Care (Revised) (Core Handbook Pediatrics) Revised ed. Edition Free - Copy URL | gooread.fileunlimited.club/pw23/0781728894 | PDF Pediatric Primary Care: Well-Child Care (Revised) (Core Handbook Pediatrics) Revised ed. Edition Android Dr. Baker's widely used Handbook of Pediatric Primary Care has now been updated and expanded into two volumes--Pediatric Primary Care: Well-Child Care and Pediatric Primary Care: Ill-Child Care. These practical handbooks provide easily accessible information on virtually every problem encountered in the primary care of children.Pediatric Primary Care: Well-Child Care focuses on health maintenance supervision and behavioral and developmental pediatrics. New chapters cover newborn screening, the sports physical, the adolescent visit, injury prevention, telephone medicine, and medical informatics. A significantly expanded behavioral and developmental section includes new chapters on negative behaviors, childhood sexuality, and attention deficit hyperactivity disorder. | PowerPoint PPT presentation | free to view

NFRA Proposes revision of Quality & Auditing Standards despite ICAI disagreement PowerPoint PPT Presentation

NFRA Proposes revision of Quality & Auditing Standards despite ICAI disagreement - he National Financial Reporting Authority (NFRA) recently convened its 18th meeting on November 11-12, 2024, to discuss updates to quality and auditing standards in alignment with global practices. NFRA recommended that the Standard on Quality Control (SQC1) be revised to become Standards on Quality Management (SQM1 and SQM2), mirroring the International Standards on Quality Management (ISQM1 and ISQM2) | PowerPoint PPT presentation | free to view