Title: Website for class notes: https:www'cvm'tamu'edubimsjunior'shtml
1Website for class noteshttps//www.cvm.tamu.edu/
bims/junior.shtml
Dr. Natalie Halbert nhalbert_at_cvm.tamu.edu 862-4774
Tutorial by Ahmed Elhameky Tuesdays 300-500 VMR
203
2Gene Expression Phenotypes
- From Chapter 11
- Human Genetics Concepts and Applications, 6th
edition - by Ricki Lewis
-
3Replication, transcription, RNA processing,
translation, protein processing, protein
modification.. WHY SHOULD YOU CARE?
4Lactose Intolerance
- Lactose is metabolized by the enzyme lactase
- splits lactose into 2 sugars, glucose and
galactose - Lactose intolerance can range from 0 to 100 in
human populations - Autosomal dominant trait
- Most land mammals and human adults are
lactose intolerant!
5Lactose Absorption in Various Populations
6Galactosemia is caused by an enzyme deficiency
- 1 in 57,000 births
- Lack of enzyme galactose-1-phosphate uridyl
transferase - Inability to break down galactose completely
- Example of a multiple allele system
- Can lead to mental retardation and death if
untreated
7Hemoglobin structure function
- Hemoglobin (Hb) is protein in red blood cells
that transports oxygen from lungs to tissues - Each red blood cell contains millions of Hb
proteins - Hb comprised of 4 polypeptide chains 2 alpha and
2 beta type - Each polypeptide chain has hydrophobic pocket
for heme group - Critical function of Hb mutations that alter
function can cause serious illness, widespread
organ tissue damage, death
8Human beta-globin gene
- Small gene (1,700 bp including promoter)
- 2 introns account for 60 of gene length
- 8 alpha-helices coil and fold around heme group
(tertiary structure) - Heme protoporphyrin ring structure surrounding
iron - Hemoglobin as O2 CO2 carrier
- Hydrophobic heme pocket has affinity for O2
molecules - Arginine residues near carboxyl end of
alpha-globin chains bind CO2 - Binding of O2 and CO2 in 2 different parts of
protein. -
but cannot be
simultaneous! - CO2 binding alters conformation decreased
affinity for O2 - Release of CO2 in lungs increases affinity for O2
9Beta-globin chain variants with single amino acid
substitutions
Substitutions at the same amino acid position can
result in drastically different phenotypes!
10Sickle cell anemia
- First illness understood at the molecular level
- 6th amino acid substitution Glu -gt Val
- Hb A Glutamic acid (normal)
- Acidic, hydrophilic amino acid
- Hb S Valine
- Nonpolar, hydrophobic amino acid
- Inherited as an autosomal recessive trait.
- Affects 1/500 African Americans
- 1/12 African Americans are heterozygous carriers
11Single base change in hemoglobin gene causes
sickle cell anemia
12Sickle cell anemia phenotype
- HbS molecules attach to each other to form long
chains when deoxygenated - HbS fibers have reduced oxygen affinity, causing
sickle shape of red blood cells - Sickle shaped RBC do not readily pass though
capillaries cause clots - Lack of oxygen accumulation of CO2 widespread
tissue damage, anemia, joint pain
13The cascade of phenotypes in sickle cell anemia
14How is HbS allele maintained?
- In heterozygotes recessive homozygotes, mutant
hemoglobin makes RBC resistant to infection by
Plasmodium falciparum - P. falciparum causes malaria
- gt 2 million people die from malaria each year
- gt300 million people infected with malaria
worldwide - HbS/HbS at disadvantage due to sickle cell anemia
- HbA/HbA homozygotes are more susceptible to
malaria - HbA/HbS heterozygotes have some effects of sickle
cell anemia, but are resistant to malaria - HbS allele maintained in population due to
heterozygote advantage (overdominance)
15Mutations in different sites of a gene can cause
distinct phenotypes ß-thalassemia
- Caused by excess of alpha hemoglobin compared to
beta hemoglobin - leads to iron release and aggregation of excess
alpha subunits RBC destroyed - expansion of bone marrow causes skeletal
deformities iron overloading causes cirrhosis of
the liver endocrine disfunction, diabetes and
cardiac failure - Ultimately, patients with severe ß-thalassemia
suffer early death - Two forms
- reduction of ß-globin synthesis (ß-thalassemia)
- mild - absence of ß-globin (ß0-thalassemia) - severe
- gt30 different mutations in ß-globin gene can
cause ß-thalassemia - Nearly half of known mutations disrupt intron
removal
16Human ß-globin gene
3
Exon 1
Intron 1
Exon 2
Intron 2
Exon 3
5
AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATC
AAGGGTTACAAAG
AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGATTGGTATC
AAGGGTTACAAAG
1
2
3
- normal intron splice site not functional due to
mutation - intron still removed, but incorrectly at one of
cryptic splice sites - cryptic splice sites only functional when
cleavage cannot occur at normal splice site - Intron 1 within reading frame for translation
(phase 2 junction) cryptic sites out - of frame, resulting in frameshift mutations
- Splicing at cryptic site 1 or 2 codons deleted
from mRNA - Splicing at cryptic site 3 new codons inserted
into mRNA
Mutant ß-globin gene fails to produce any
functional ß-globin ß0-thalassemia
17Human ß-globin gene
Exon 1
Intron 1
Exon 2
Intron 2
Exon 3
5
3 UTR
CTGCCTAATAAAAAA
AAUAAA polyadenylation signal
CTGCCTAAAAAAAAA
- T-gtA mutation disrupts proper polyadenylation
- Why would this mutation cause ß-thalassemia
(mild form)?
18(No Transcript)
19Pharmacogenetics
- A relatively new area of genetics that studies
the genetic variations that underlie drug or
chemical responses. - Drug resistance
- Toxic sensitivity to low drug doses
- Development of cancer after prolonged exposure
- Unusual reaction to drug combination
- Example
- Phenylthiocarbamide (PTC) tasting in humans.
- TT and Tt tasters
- tt non-tasters 30 in U.S. Caucasians
vs. 10 in blacks - Phenotype is affected by modifying genes
20PTC/PROP
- Some food plants contain a PTC-like compound,
PROP - Kale, cabbage, broccoli, Brussels sprouts
- Capsaicin has a more intense taste to PTC/PROP
tasters - Sucrose and artificial sweeteners are more
intense to tasters - Tasters tend to dislike black coffee, dark beer,
anchovies and strong cheeses.
21Genetics of smell
- 100-1,000 membrane proteins involved in detection
of smell on surface of cells in nose and sinuses - Some people cannot smell the odor released by
skunks!
2/3 of the people tested could smell the pink
verbena but not the red verbena
1/3 of the people tested could smell the red
verbena but not the pink verbena
22Ecogenetics
- The study of genetic variation leading to
different responses to environmental chemicals. - Drugs
- Pesticides
- Foods
- Toxins
- Remember, we are all
- genetically unique.