Molecular Epidemiology: Impact on Food Regulation and Future Needs

1
Molecular EpidemiologyImpact on Food Regulation
and Future Needs

• Bala Swaminathan, Ph.D.
• Vice-President, IHRC, Inc.
• Atlanta, GA, USA

2
Epidemiology

• Epidemiology the study of the distribution and
  determinants of health-related states in
  specified populations, and the application of
  this study to control health problems.
• Epidemiologists
• collect data about an entire population through
  surveillance systems or descriptive
  epidemiological studies.
• use these data to generate hypotheses about the
  relationships between exposure and disease.
• test the hypotheses by conducting analytical
  studies such as cohort or case-control studies.
• use the findings from these studies to develop,
  recommend and/or implement some form of community
  intervention to end the health problem and
  prevent its recurrence.

3
Molecular Biology

• Molecular biology involves the study of
  macromolecules (DNA, RNA, proteins) and the
  macromolecular mechanisms found in living things,
  such as the molecular nature of the gene and its
  mechanisms of gene replication, mutation, and
  expression.
• In the context of infectious disease
  epidemiology, the molecular biologic approach
  involves molecular characterization of disease
  causing organisms and their subdivision by their
  DNA, RNA and/or proteins.
• DNA fingerprinting
• Subtyping
• Molecular subtyping

4
Molecular Epidemiology Epidemiology of disease
in affected population Molecular
Characterization (subtyping) of Etiologic Agent

• Synergy between two seemingly disparate
  scientific disciplines

5
Example of Molecular Subtyping
PulseNet Universal Reference Standard
Fragment Size
1135 Kb
452.7 Kb
216.9 Kb
76.8 Kb
33.3 Kb
A typical E. coli O157H7 PFGE Gel
6

• National network of public health laboratories
• State and local public health departments and
  Federal agencies (CDC, USDA-FSIS, FDA)
• Routinely perform standardized molecular
  subtyping of foodborne disease-causing bacteria
• Share DNA fingerprints electronically in
  real-time via Internet
• Dynamic database of DNA fingerprints at CDC

7
(No Transcript)
8
Participation in PulseNet International
33
13
13
9
E. Coli O157 Outbreak Minnesota, 2000
Courtesy John Besser, MN State Health Dept
10
Courtesy John Besser, MN State Health Dept
11
Criminal investigation
Outbreak investigation
Courtesy John Besser, Minnesota Dept. of Health
12
What are the Standards of Evidence for Molecular
Epidemiology?

• Strong epidemiologic association between illness
  in outbreak-related cases and implicated food
• Pathogen isolated from implicated food
• Pathogen isolates subtyped validated methods
• Pathogen subtyping data corroborate epidemiologic
  findings (case patient isolates are
  indistinguishable/nearly indistinguishable from
  implicated food isolates)
• If subtyping data do not corroborate
  epidemiologic findings, appropriate and
  acceptable explanation of discrepancy

13
E. coli O157 Outbreak 0609mlEXH-2
No. entries in The PulseNet database
before 8/15/2006 N 22,532 157 (0.7) 594 (2.6)
Extra band at approx. 145Kb
EXHX01.0124
EXHX01.0047
For outbreak detection, must use stringent
criteria to define subtype of outbreak strain
unless epidemiologic findings indicate the need
more inclusive criteria
14

• Impact of Molecular Epidemiology on Food
  Regulation
• Incidence of reported cases and outbreaks of
  listeriosis in the
• United States, 1986-2002

Multistate outbreak
PulseNet begins subtyping Listeria
Single state outbreak
Data from active surveillance systems, Some
data are preliminary
15
Impact of Molecular Epidemiology on Food
Regulatory Policy Recent Example

• Recent outbreaks involving frozen processed foods
  that are not fully-cooked but require microwave
  cooking or conventional cooking before
  consumption.
• Largest of these outbreaks spanned a period of
  more than one year, and caused illness in more
  than 400 people in 41 states.
• Vehicle of transmission in this outbreak frozen
  pot pies containing poultry meat
• Pathogen was Salmonella serotype Typhimurium or a
  monophasic variant of the same serotype .
• Two other salmonellosis outbreaks detected and
  investigated in Minnesota between 2005 and 2006.
• Frozen, pre-browned, single-serving, microwavable
  stuffed-chicken entrees were involved in both
  outbreaks.
• Between 1998 and 2005, Minnesota had detected two
  more outbreaks caused by similar products

• Common features of all outbreaks
• Molecular epidemiology enabled public health
  authorities to recognize and promptly investigate
  the outbreaks
• Posting of the outbreak pattern on the national
  PulseNet database served as the trigger for other
  states to look for cases in their own states
• although the packages of the products implicated
  in these outbreaks had cooking instructions
  which, if strictly followed, may have inactivated
  the Salmonella, the presentation and packaging
  of the product may have led the consumer to
  assume that they were fully cooked and,
  therefore, only needed to be heated to an
  appropriate temperature for consumption.

Remedies Better labeling and Consumer Education
16
Public Health Impact of Molecular Epidemiology

• If only 5 cases of E. coli O157H7 infections
  were averted by the recall of ground beef
• in the Colorado outbreak, the PulseNet system
  would have recovered all costs for
• start up and operation for 5 years. (Elbasha et
  al. Emerg. Infect. Dis. 6293-297, 2000)

17
Largest U.S. Food Recalls (gt 750,000 lbs) in
which Molecular Epidemiology Has Played a
Prominent Role
Total 513,950,000 lbs
other recent notable outbreaks
18
Molecular Epidemiology Further Improvements
Needed

• Reduce delays in pathogen subtyping and
  submission of patterns to national databases
• Implement more discriminating and
  epidemiologically relevant subtyping methods to
  complement or replace existing methods PFGE will
  continue to be used for the next few years
• Reduce/eliminate disparities in state/local
  capacities for molecular epidemiology of
  foodborne diseases

• Develop/implement innovative strategies for
  timely and routine gathering of epidemiologic
  data independently and in parallel with molecular
  subtyping
• Team Diarrhea concept works Can the Team
  Diarrhea approach be replicated in other states,
  regionally or nationally?

19
Next Generation Subtyping Methods for Molecular
Epidemiology

• MLVA typing
• Already in use for E. coli O157H7 subtyping in
  PulseNet
• SNP (single nucleotide polymorphism) analysis
• Under development and evaluation
• Whole genome sequencing
• On the horizon

20
Multilocus VNTR Analysis(MLVA)

• Variable Number Tandem Repeats (VNTRs) in
  non-coding sequences
• Conserved repeat motif found in the genome
• Example TAACCG
• Variable numbers of repeat units among isolates
  of the same species
• MLVA examines the number of repeats at multiple
  loci to determine genetic relationships

Number of repeats
1 2 4 5
TAACCG
TAACCGTAACCG
TAACCGTAACCGTAACCGTAACCG
TAACCGTAACCGTAACCGTAACCGTAACCG
21
Variable Number Tandem RepeatsVNTRs
22
Multiple Locus VNTR Analysis can bedeveloped
from low-pass sequence data
23
Clustering of outbreak isolates and some selected
sporadic isolates by MLVA
GA water park outbreak
CT apple cider outbreak
CO outbreak
NJ outbreak
Western States outbreak
WI restaurant outbreak
NY County Fair
MI outbreak
24
Manning, et al. (2008)