Title: SSR
1SSR
2SSR
- SSR is also known as microsatellite or short
tandem repeat (STR). - segment of DNA consists of tandemly repeated
unit, each between 1 and 10 base-pairs in length,
such as (TG)n or (AAT)n. - (TG)8 TGTGTGTGTGTGTGTG
- (AAT)6 AATAATAATAATAATAAT
(CA)8
3SSR
- it was studied in human (1989), and was found to
be common in plants and animals. - they are widely dispersed throughout eukaryotic
genomes and often highly polymorphic due to
variation in the number of repeat units. - it shows high level of intra and interspecific
variation. - these high rates of mutation can be explained
most frequently by slipped strand mispairing
(slippage) during DNA replication. - mutation may also occur during recombination
during meiosis.
4Types of SSR
(A)n, (T)n, (C)n, (G)n mononucleotide
SSRs (AT)n, (CG)n, (GT)n dinucleotide SSRs
(ATT)n, (CCG)n, (GTA)n trinucleotide
SSRs (CCGG)n, (TATC)n tetranucleotide SSRs
5Types of SSR
Compound SSRs ATATATATCACACAATATATATCACACA
- (AT)4(CA)3 CCGCCGATATATATCCGCCGATATATAT -
(CCG)3(AT)4
6Types of SSR
Perfect SSR motifs AAAAAAAAAAAA -
(A)12 ATATATATATATATATAT -
(AT)9 CCGCCGCCGCCGCCGCCGCCG -
(CCG)7 Imperfect SSR motifs AAAAATAAAAAAAA
- (A)14 ATATATATACATATATAT - (AT)9
7How to detect SSR?
- these tandemly repeated units are usually
franked by unique conserved sequences. Therefore,
primers could be designed to amplify the SSRs.
8- detection of variation in SSR can be done using
metaphor agarose gel or polyacrylamide gel. - variation between individuals is because of
different alelles due to the number of tandemly
repeated units.
9Characteristics of SSR
- each SSR is controlled by one locus.
- each locus is controlled by many alleles (2-16
alleles). - mutational rates are high in microsatellite
regions. - it is co-dominantly inherited.
- the franking regions of SSR are conserved within
species.
10(No Transcript)
11Stutter Bands in SSR
- very often there are minor bands in addition to
the major bands. These minor bands are called
stutter bands (shadow bands) and they usually
differ (smaller in size) from the major bands by
a few nucleotides. - these stutter bands arise from slipped-strand
mispairing during PCR.
12SSR
- PCR amplification protocols used for SSRs are
general standard. - several PCR products (different SSR loci) can be
pooled (multiplexing) for electrophoresis.
Multiplexing allows rapid genotyping of large
sample sizes across several loci.
13Multiplexing in SSRs
Locus A
Locus B
14(No Transcript)
15EST-SSR
- EST (Expressed Seqeunce Tag) sequences are
generated from cDNA (may be derived from cDNA
library). - these ESTs may contain SSR motifs. Tandem Repeat
Finder (a computer software) is normally used to
screen SSR motifs from ESTs. - the SSR derived from EST is called EST-SSR. They
normally contain trinucleotide repeat units. - primers to amplify EST-SSR are designed based on
the EST sequence franking the SSR motif. - EST-SSR is particularly useful for QTL mapping.
16Transferability of SSRs
- SSR primers developed for one particular species
are normally applicable across wide range of
related species. - Examples
- SSR transferability from lychee to pulasan is 58
- SSR transferability from lychee to logan is 92
- the rate of transferability depends on the
evolutionary distance and the complexity of the
genome of the species. - transferability is normally higher for EST-SSRs
compared to SSRs.
17SSR
- Disadvantage high cost in developing the SSR
primers. - Advantage primers developed for one particular
species are normally applicable across wide range
of related species.