376 Blosum PPTs View free & download

MATRICES PAM Y BLOSUM PowerPoint PPT Presentation

MATRICES PAM Y BLOSUM - Matrices de sustituci n de amino cidos Las sustituciones de aa m s comunes se dan entre aquellos de estructura qu micamente parecidos. Sabiendo los tipos de ...

Matrices de sustituci n de amino cidos Las sustituciones de aa m s comunes se dan entre aquellos de estructura qu micamente parecidos. Sabiendo los tipos de ...

| PowerPoint PPT presentation | free to view

The Blosum scoring matrices Morten Nielsen BioSys, DTU - The Blosum scoring matrices Morten Nielsen BioSys, DTU

The Blosum scoring matrices Morten Nielsen BioSys, DTU

| PowerPoint PPT presentation | free to view

----???????(Principles of Scoring Matrices) PowerPoint PPT Presentation

----???????(Principles of Scoring Matrices) - ---- (Principles of Scoring Matrices) Blosum (The Blosum matrices)

---- (Principles of Scoring Matrices) Blosum (The Blosum matrices)

| PowerPoint PPT presentation | free to view

Scoring the Alignment of Amino Acid Sequences PowerPoint PPT Presentation

Scoring the Alignment of Amino Acid Sequences - Scoring the Alignment of Amino Acid Sequences Constructing PAM and Blosum Matrices

Scoring the Alignment of Amino Acid Sequences Constructing PAM and Blosum Matrices

| PowerPoint PPT presentation | free to download

Why is pairwise sequence alignment different PowerPoint PPT Presentation

Why is pairwise sequence alignment different - ... pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA ... worm. The following matrices are roughly equivalent... PAM100 == Blosum90. PAM120 == Blosum80 ...

... pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA ... worm. The following matrices are roughly equivalent... PAM100 == Blosum90. PAM120 == Blosum80 ...

| PowerPoint PPT presentation | free to view

Bioinformatics 1 lecture 6 PowerPoint PPT Presentation

Bioinformatics 1 lecture 6 - Affine gap penalty. Substitution Matrices. PAM. BLOSUM. Matrix bias in ... Rules for affine gap penalty DP. Do not ... Affine gap penalty. How many ways are ...

Affine gap penalty. Substitution Matrices. PAM. BLOSUM. Matrix bias in ... Rules for affine gap penalty DP. Do not ... Affine gap penalty. How many ways are ...

| PowerPoint PPT presentation | free to view

Similar Sequence Similar Function PowerPoint PPT Presentation

BLOSUM 62 is a matrix calculated from comparisons of sequences with no less than ... The p value is calculated by relating the observed alignment score, S, to the ...

| PowerPoint PPT presentation | free to view

Pairwise alignment PowerPoint PPT Presentation

Pairwise alignment - C G P S A T D E N Q H K R V M I L F Y W. BLOSUM62. G 7. P -2 9. D -1 -1 7. E -2 0 2 6. N 0 -2 2 0 6 ... Q K R S T A M V I L F Y W C. The genetic code ...

C G P S A T D E N Q H K R V M I L F Y W. BLOSUM62. G 7. P -2 9. D -1 -1 7. E -2 0 2 6. N 0 -2 2 0 6 ... Q K R S T A M V I L F Y W C. The genetic code ...

| PowerPoint PPT presentation | free to view

LSM2104 Part II Lectures 3 and 4 PowerPoint PPT Presentation

LSM2104 Part II Lectures 3 and 4 - Derivation of PAM and BLOSUM and Scoring Matrices. Basic Introduction to Dynamic Programming Techniques ... MSA ( Gupta, Kececioglu & Schaffer, 1995) MACAW ( Schu ...

Derivation of PAM and BLOSUM and Scoring Matrices. Basic Introduction to Dynamic Programming Techniques ... MSA ( Gupta, Kececioglu & Schaffer, 1995) MACAW ( Schu ...

| PowerPoint PPT presentation | free to view

Fasta, Blast, Probabilities PowerPoint PPT Presentation

Fasta, Blast, Probabilities - ... T with substrings of s in a gapless alignment (k = 4 for proteins, 11 for DNA) ... in the text book). Considered state of the art nowadays. 50. BLOSUM 62 ...

... T with substrings of s in a gapless alignment (k = 4 for proteins, 11 for DNA) ... in the text book). Considered state of the art nowadays. 50. BLOSUM 62 ...

| PowerPoint PPT presentation | free to view

A Practical Approach to Significance Assessment in Alignments with Gaps PowerPoint PPT Presentation

A Practical Approach to Significance Assessment in Alignments with Gaps - A Practical Approach to Significance Assessment in Alignments ... to more complex scoring systems (affine gap costs, correlated bonds, PAM or BLOSUM matrices) ...

A Practical Approach to Significance Assessment in Alignments ... to more complex scoring systems (affine gap costs, correlated bonds, PAM or BLOSUM matrices) ...

| PowerPoint PPT presentation | free to view

Sequence Analysis Methods for comparative Genomics PowerPoint PPT Presentation

Sequence Analysis Methods for comparative Genomics - Identity-difference (default 1, 3), affine gap penalties. Blosum or Pam substitution matrix, affine gap penalties. Scoring system: ...

Identity-difference (default 1, 3), affine gap penalties. Blosum or Pam substitution matrix, affine gap penalties. Scoring system: ...

| PowerPoint PPT presentation | free to view

BLAST - Basic Local Alignment Search Tool. Rapid Searching of Protein & nucleotide DBs ... Space introduced into alignment to compensate for insertions/deletions in 1 ...

Basic Local Alignment Search Tool. Rapid Searching of Protein & nucleotide DBs ... Space introduced into alignment to compensate for insertions/deletions in 1 ...

| PowerPoint PPT presentation | free to download

GLOBAL PAIRWISE ALIGNMENT GLOBAL ALIGNMENT OF: 2 NUCLEOTIDE SEQUENCES OR 2 AMINO-ACID SEQUENCES PowerPoint PPT Presentation

GLOBAL PAIRWISE ALIGNMENT GLOBAL ALIGNMENT OF: 2 NUCLEOTIDE SEQUENCES OR 2 AMINO-ACID SEQUENCES - GLOBAL PAIRWISE ALIGNMENT GLOBAL ALIGNMENT OF: 2 NUCLEOTIDE SEQUENCES OR 2 AMINO-ACID SEQUENCES * To derive a mutational probability matrix for a protein sequence ...

GLOBAL PAIRWISE ALIGNMENT GLOBAL ALIGNMENT OF: 2 NUCLEOTIDE SEQUENCES OR 2 AMINO-ACID SEQUENCES * To derive a mutational probability matrix for a protein sequence ...

| PowerPoint PPT presentation | free to download

Basics of Sequence Alignment and Weight Matrices and DOT Plot PowerPoint PPT Presentation

Basics of Sequence Alignment and Weight Matrices and DOT Plot - Basics of Sequence Alignment and Weight Matrices and DOT Plot G P S Raghava Email: raghava@imtech.res.in Web: http://imtech.res.in/raghava/

Basics of Sequence Alignment and Weight Matrices and DOT Plot G P S Raghava Email: raghava@imtech.res.in Web: http://imtech.res.in/raghava/

| PowerPoint PPT presentation | free to download

Scoring Matrices PowerPoint PPT Presentation

Scoring Matrices - Scoring matrices implicitly represent a particular theory of evolution ... Mutations accepted by natural selection. Constructing PAM Matrix: Training Data ...

Scoring matrices implicitly represent a particular theory of evolution ... Mutations accepted by natural selection. Constructing PAM Matrix: Training Data ...

| PowerPoint PPT presentation | free to view

Scoring matrices - Identity matrix exact matches receive one score and non-exat matches a ... Isoleucine for Valine (both small, hydrophobic) Serine for Threonine (both polar) ...

Identity matrix exact matches receive one score and non-exat matches a ... Isoleucine for Valine (both small, hydrophobic) Serine for Threonine (both polar) ...

| PowerPoint PPT presentation | free to download

Identifying sequences with PowerPoint PPT Presentation

Identifying sequences with - Optimal alignment between two sequences containing as many characters of the query as ... helices, ...) Background. Score: -42 at (seq1)[1..90] : (seq2)[1..90] ...

Optimal alignment between two sequences containing as many characters of the query as ... helices, ...) Background. Score: -42 at (seq1)[1..90] : (seq2)[1..90] ...

| PowerPoint PPT presentation | free to view

Pairwise and Multiple Sequence Alignment Lesson 2 PowerPoint PPT Presentation

Pairwise and Multiple Sequence Alignment Lesson 2 - Pairwise and Multiple Sequence Alignment Lesson 2 Motivation What is sequence alignment? Alignment: Comparing two (pairwise) or more (multiple) sequences.

Pairwise and Multiple Sequence Alignment Lesson 2 Motivation What is sequence alignment? Alignment: Comparing two (pairwise) or more (multiple) sequences.

| PowerPoint PPT presentation | free to view

PAIRWISE ALIGNMENT ALIGNMENT OF TWO NUCLEOTIDE OR TWO AMINOACID SEQUENCES PowerPoint PPT Presentation

PAIRWISE ALIGNMENT ALIGNMENT OF TWO NUCLEOTIDE OR TWO AMINOACID SEQUENCES - The units in a scoring matrix may be the nucleotides in DNA or RNA sequences, ... The number of possible alignments may be astronomical. ...

The units in a scoring matrix may be the nucleotides in DNA or RNA sequences, ... The number of possible alignments may be astronomical. ...

| PowerPoint PPT presentation | free to view

Heuristic approaches PowerPoint PPT Presentation

Heuristic approaches - BIOTECHNOLOGY

BIOTECHNOLOGY

| PowerPoint PPT presentation | free to download

Sequence Alignment and Phylogeny PowerPoint PPT Presentation

Sequence Alignment and Phylogeny - Sequence Alignment and Phylogeny B I O I N F O R M A T I C S | | | | | | | B I O L O G Y - M A T H - S Dr Peter Smooker, peter.smooker@rmit.edu.au

Sequence Alignment and Phylogeny B I O I N F O R M A T I C S | | | | | | | B I O L O G Y - M A T H - S Dr Peter Smooker, peter.smooker@rmit.edu.au

| PowerPoint PPT presentation | free to view

Basics of Sequence Alignment and Weight Matrices and DOT Plot - Basics of Sequence Alignment and Weight Matrices and DOT Plot G P S Raghava Email: raghava@imtech.res.in Web: http://imtech.res.in/raghava/ Importance of Sequence ...

Basics of Sequence Alignment and Weight Matrices and DOT Plot G P S Raghava Email: raghava@imtech.res.in Web: http://imtech.res.in/raghava/ Importance of Sequence ...

| PowerPoint PPT presentation | free to view

Bioinformatics in Drug Design PowerPoint PPT Presentation

Bioinformatics in Drug Design - Title: Bioinformatics in Drug Design Subject: outline Author: pirovano Last modified by: heringa Created Date: 11/9/2006 3:32:34 PM Category: lecture series

Title: Bioinformatics in Drug Design Subject: outline Author: pirovano Last modified by: heringa Created Date: 11/9/2006 3:32:34 PM Category: lecture series

| PowerPoint PPT presentation | free to download

CSE182-L4:%20Scoring%20matrices,%20Dictionary%20Matching PowerPoint PPT Presentation

CSE182-L4:%20Scoring%20matrices,%20Dictionary%20Matching - Title: L3: Blast: Keyword match basics Author: Vineet Bafna Last modified by: Vineet Bafna Created Date: 10/4/2005 8:32:21 AM Document presentation format

Title: L3: Blast: Keyword match basics Author: Vineet Bafna Last modified by: Vineet Bafna Created Date: 10/4/2005 8:32:21 AM Document presentation format

| PowerPoint PPT presentation | free to download

Pairwise sequence PowerPoint PPT Presentation

Pairwise sequence - Pairwise sequence Alignment Homology, Score Matrix

Pairwise sequence Alignment Homology, Score Matrix

| PowerPoint PPT presentation | free to download

Roadmap - Sequence alignments Introduction What is an alignment? ... Retrovirus had acquired the gene from the host cell as some kind of genetic ... Bioinformatics Author:

Sequence alignments Introduction What is an alignment? ... Retrovirus had acquired the gene from the host cell as some kind of genetic ... Bioinformatics Author:

| PowerPoint PPT presentation | free to download

Sequence Alignment - Sequence Alignment

Sequence Alignment

| PowerPoint PPT presentation | free to view

Alignment methods II PowerPoint PPT Presentation

Alignment methods II - 1) Understand how Global alignment program works using the longest ... Position at current cell and look at direct predecessors. Seq#1 G A A T T C A G T T A ...

1) Understand how Global alignment program works using the longest ... Position at current cell and look at direct predecessors. Seq#1 G A A T T C A G T T A ...

| PowerPoint PPT presentation | free to view

Chapter 2 Data Searches and Pairwise Alignments PowerPoint PPT Presentation

Chapter 2 Data Searches and Pairwise Alignments - Chapter 2 Data Searches and Pairwise Alignments 2004/03/08

Chapter 2 Data Searches and Pairwise Alignments 2004/03/08

| PowerPoint PPT presentation | free to view

Scoring Matrices - It is easy to score if an amino acid is identical to another (the score is 1 if ... a score for amino acids that are somewhat ... Amino Acid Scoring Matrices ...

It is easy to score if an amino acid is identical to another (the score is 1 if ... a score for amino acids that are somewhat ... Amino Acid Scoring Matrices ...

| PowerPoint PPT presentation | free to view

Pair-Wise Sequence Alignment Methods and Tools PowerPoint PPT Presentation

Pair-Wise Sequence Alignment Methods and Tools - The second approach for scanning a database is to construct a deterministic finite automata ... FastA is an algorithm that attempts to speed up string matching over ...

The second approach for scanning a database is to construct a deterministic finite automata ... FastA is an algorithm that attempts to speed up string matching over ...

| PowerPoint PPT presentation | free to view

Homework assignments PowerPoint PPT Presentation

Homework assignments - Biological entities share common ancestry. 4 ... Similarity is mostly indicative of common ancestry. 31. Identify functional parts ...

Biological entities share common ancestry. 4 ... Similarity is mostly indicative of common ancestry. 31. Identify functional parts ...

| PowerPoint PPT presentation | free to view

Introduction to Bioinformatics PowerPoint PPT Presentation

Introduction to Bioinformatics - Introduction to Bioinformatics Lecture 6 Substitution matrices Archaea PAM model The scores derived through the PAM model are an accurate description of the ...

Introduction to Bioinformatics Lecture 6 Substitution matrices Archaea PAM model The scores derived through the PAM model are an accurate description of the ...

| PowerPoint PPT presentation | free to download

Pairwise Sequence Alignment and Scoring Matrices PowerPoint PPT Presentation

Pairwise Sequence Alignment and Scoring Matrices - Title: PowerPoint Presentation Author: Xiaole Shirley Liu Last modified by: Jun Liu Created Date: 1/3/2005 7:27:35 PM Document presentation format

Title: PowerPoint Presentation Author: Xiaole Shirley Liu Last modified by: Jun Liu Created Date: 1/3/2005 7:27:35 PM Document presentation format

| PowerPoint PPT presentation | free to view

Protein Evolution and PowerPoint PPT Presentation

Protein Evolution and - Protein Evolution and Sequence Analysis Significant sequence similarity allows one to assign function to an unknown protein(s) based on properties of known proteins ...

Protein Evolution and Sequence Analysis Significant sequence similarity allows one to assign function to an unknown protein(s) based on properties of known proteins ...

| PowerPoint PPT presentation | free to download

Alignment and Algorithms PowerPoint PPT Presentation

Alignment and Algorithms - Alignment and Algorithms Scoring Matrices: models of evolution Dynamic Program: speed Pairwise Sequence Alignment, variants Significance Pattern recognition, Hidden ...

Alignment and Algorithms Scoring Matrices: models of evolution Dynamic Program: speed Pairwise Sequence Alignment, variants Significance Pattern recognition, Hidden ...

| PowerPoint PPT presentation | free to download

Diapositiva 1 PowerPoint PPT Presentation

Diapositiva 1 - http://creativecommons.org/licenses/by-sa/2.0/

http://creativecommons.org/licenses/by-sa/2.0/

| PowerPoint PPT presentation | free to download

Finding identities and similarities in nucleotide and protein sequences: What proteins are like mine? What the evolutionary history? Can I infer function of my gene/protein? - Finding identities and similarities in nucleotide and protein sequences: What proteins are like mine? What the evolutionary history? Can I infer function of my gene ...

Finding identities and similarities in nucleotide and protein sequences: What proteins are like mine? What the evolutionary history? Can I infer function of my gene ...

| PowerPoint PPT presentation | free to view

Amino Acid Scoring Matrices PowerPoint PPT Presentation

Amino Acid Scoring Matrices - Metric Conversions. Proteins. 3-dimensional stuctures. Composed of amino acids chained together ... is found using a metric, resulting alignment scores are ...

Metric Conversions. Proteins. 3-dimensional stuctures. Composed of amino acids chained together ... is found using a metric, resulting alignment scores are ...

| PowerPoint PPT presentation | free to download

Substitution Matrices and Alignment Statistics PowerPoint PPT Presentation

Substitution Matrices and Alignment Statistics - let be the frequency of amino acid a. consider case where alignment of x and y is random: ... of the individual amino acids. Statistics of Alignment Scores ...

let be the frequency of amino acid a. consider case where alignment of x and y is random: ... of the individual amino acids. Statistics of Alignment Scores ...

| PowerPoint PPT presentation | free to download

Allineamenti e Misure di Similarit PowerPoint PPT Presentation

Allineamenti e Misure di Similarit - Title: Concetti introduttivi all analisi delle Biosequenze Author: pp pp Last modified by: mfasano Created Date: 5/1/2002 4:20:34 PM Document presentation format

Title: Concetti introduttivi all analisi delle Biosequenze Author: pp pp Last modified by: mfasano Created Date: 5/1/2002 4:20:34 PM Document presentation format

| PowerPoint PPT presentation | free to view

Presentaci - Alineamiento de secuencias. B squeda de hom logos. Alineamientos m ltiples. Patrones y perfiles. Curso de verano de Bioinform tica de la UCM

Alineamiento de secuencias. B squeda de hom logos. Alineamientos m ltiples. Patrones y perfiles. Curso de verano de Bioinform tica de la UCM

| PowerPoint PPT presentation | free to download

Sequence Alignment - sequence alignment aggctatcacctgacctccaggccgatgccc tagctatcacgaccgcggtcgatttgcccgac-aggctatcacctgacctccaggccga--tgccc---tag-ctatcac--gaccgc--ggtcgatttgcccgac

sequence alignment aggctatcacctgacctccaggccgatgccc tagctatcacgaccgcggtcgatttgcccgac-aggctatcacctgacctccaggccga--tgccc---tag-ctatcac--gaccgc--ggtcgatttgcccgac

| PowerPoint PPT presentation | free to download

Biologia computazionale PowerPoint PPT Presentation

Biologia computazionale - UNIVERSIT DEGLI STUDI DI MILANO Docente: Giulio Pavesi Tutor: Matteo Re C.d.l. Biotecnologie Industriali e Ambientali Biologia computazionale

UNIVERSIT DEGLI STUDI DI MILANO Docente: Giulio Pavesi Tutor: Matteo Re C.d.l. Biotecnologie Industriali e Ambientali Biologia computazionale

| PowerPoint PPT presentation | free to download

Sequence Alignment - Use of the amino acid similarities based on physico-chemical properties ... a is mutated to an amino acid x in the first PAM, and then to b in the next, ...

Use of the amino acid similarities based on physico-chemical properties ... a is mutated to an amino acid x in the first PAM, and then to b in the next, ...

| PowerPoint PPT presentation | free to download

Algorithms in Bioinformatics PowerPoint PPT Presentation

Algorithms in Bioinformatics - If the algorithm works with n pieces of data and the number of steps is ... Smith-Waterman algorithm. Includes a fourth possibility at each step (don't align) ...

If the algorithm works with n pieces of data and the number of steps is ... Smith-Waterman algorithm. Includes a fourth possibility at each step (don't align) ...

| PowerPoint PPT presentation | free to download

Homework 1 and 2 review session PowerPoint PPT Presentation

Homework 1 and 2 review session - Title: PowerPoint Presentation Author: Kirill Last modified by: Kyrylo Bessonov Created Date: 8/16/2006 12:00:00 AM Document presentation format: On-screen Show (4:3)

Title: PowerPoint Presentation Author: Kirill Last modified by: Kyrylo Bessonov Created Date: 8/16/2006 12:00:00 AM Document presentation format: On-screen Show (4:3)

| PowerPoint PPT presentation | free to download

BCB 444/544 - BCB 444/544 F07 ISU Dobbs - Lab 3 - BLAST. 2. Exhaustive vs Heuristic Methods ... Today's Lab: focus on BLAST. Basic Local Alignment Search Tool. STEPS: ...

BCB 444/544 F07 ISU Dobbs - Lab 3 - BLAST. 2. Exhaustive vs Heuristic Methods ... Today's Lab: focus on BLAST. Basic Local Alignment Search Tool. STEPS: ...

| PowerPoint PPT presentation | free to view

BLAST I - Jian Ye, Scott McGinnis, and Thomas L. Madden (2006) 'BLAST: ... aliphatic. aromatic. small. tiny. hydrophobic. Scoring Matrix. From: www.sanbi.ac.za/ 28 ...

Jian Ye, Scott McGinnis, and Thomas L. Madden (2006) 'BLAST: ... aliphatic. aromatic. small. tiny. hydrophobic. Scoring Matrix. From: www.sanbi.ac.za/ 28 ...

| PowerPoint PPT presentation | free to view

What is BLAST? BLAST (Basic Local Alignment Search Tool) is PowerPoint PPT Presentation

What is BLAST? BLAST (Basic Local Alignment Search Tool) is - What is BLAST? BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases ...

What is BLAST? BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases ...

| PowerPoint PPT presentation | free to view

Dynamic-Programming%20Strategies%20for%20Analyzing%20Biomolecular%20Sequences PowerPoint PPT Presentation

Dynamic-Programming%20Strategies%20for%20Analyzing%20Biomolecular%20Sequences - Dynamic-Programming Strategies for Analyzing Biomolecular Sequences

Dynamic-Programming Strategies for Analyzing Biomolecular Sequences

| PowerPoint PPT presentation | free to download

ALIGNMENT - Local alignment (Smith-Waterman) BLAST (simplified Smith-Waterman) FASTA (simplified Smith-Waterman) BESTFIT (GCG program) Global alignment (Needleman-Wunsch) ...

Local alignment (Smith-Waterman) BLAST (simplified Smith-Waterman) FASTA (simplified Smith-Waterman) BESTFIT (GCG program) Global alignment (Needleman-Wunsch) ...

| PowerPoint PPT presentation | free to view

Introduction to Bioinformatics - Introduction to Bioinformatics Alexandra M Schnoes Univ. California San Francisco Alexandra.Schnoes@ucsf.edu

Introduction to Bioinformatics Alexandra M Schnoes Univ. California San Francisco Alexandra.Schnoes@ucsf.edu

| PowerPoint PPT presentation | free to download

Ricerca di similarit PowerPoint PPT Presentation

Title: ENTREZ Author: Bepin Deeto Last modified by: Maelstrom Created Date: 11/7/2001 8:23:01 PM Document presentation format: On-screen Show Company

| PowerPoint PPT presentation | free to view

Bioinformatics PowerPoint PPT Presentation

Bioinformatics - Bioinformatics CSC 391/691; PHY 392; BICM 715 Importance of bioinformatics A more global perspective in experimental design The ability to capitalize on the emerging ...

Bioinformatics CSC 391/691; PHY 392; BICM 715 Importance of bioinformatics A more global perspective in experimental design The ability to capitalize on the emerging ...

| PowerPoint PPT presentation | free to view

Blosum PowerPoint PPT Presentations