Title: Introduction to NCBI and Name that Gene
1Introduction to NCBIand Name that Gene
2Access the National Center for Biotechnology
Information www.ncbi.nlm.nih.gov
Established in 1988 National resource for
molecular biology information
3NCBI GenBank database of known nucleotide
and protein sequences PubMed all medically
relevant scientific literature OMIM Online
Mendelian Inheritance in Man reviews all known
info about genetic disorders in man BLAST tool
for retrieval of nucleotide and protein sequences
4Location for GenBank
5All Medically Relevant Published Academic
Literature
More Readable Information about genetic
disorders
6OMIM-all known information (literature and
molecular data) for identified human genes
7Access to DNA and Protein Sequences
8Activity 1
Name That Gene
9Objective Identify a Gene
- Use tools in NCBI website
- Using an unknown DNA sequence, do a BLAST search
- Access Genes Diseases to find
- Symptoms
- Chromosome number
- Gene locus for genetic disorder
10(No Transcript)
11(No Transcript)
12ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTT
CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
AGC
13(No Transcript)
14(No Transcript)
15Scroll Down
16Nucleotide Sequence of Gene can determine of
base pairs in gene
17(No Transcript)
18(No Transcript)
19(No Transcript)
20(No Transcript)