Title: Bioinformatics group
1AACATACCTGCTTTATGCACTCAAGCAGAGAAGAAATCCACAAGTACTCA
CCAGCCTCCTGGTCTGCAGAGAAGACAGAATCAATATGAGCACAGCAGGA
AAAGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGTTAAAGAAACCCTT
TTCCATTGAGGAGGTAGAGGTTGCACCTCCTAAGGCTCATGAAGTTCGCA
TTAAGATGGTGGCTGCAGGAATCTGTCGTTCAGATGAGCATGTGGTTAGT
GGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGG
CATCGTGGAAAGTGTTGGAGAAGGGGTGACTACAGTCAAACCAGGTGATA
AAGTCATCCCGCTCTTTACTCCTCAGTGTGGAAAATGCAGAATTTGTAAA
AACCCAGAAAGCAACTACTGCTTGAAAAATGATCTAGGCAATCCTCGGGG
GACCCTGCAGGATGGCACCAGGAGGTTCACCTGCAGCGGGAAGCCCATCC
ACCACTTCGTCGGCGTCAGCACCTTCTCCCAGTACACAGTGGTGGATGAG
AATGCAGTGGCCAAAATTGATGCAGCCTCGCCCCTGGAGAAAGTCTGCCT
CATTGGCTGTGGATTTTCGACTGGTTATGGGTCTGCAGTCAAAGTTGCCA
AGGTCACCCCAGGGTCTACCTGTGCTGTGTTTGGCCTGGGAGGGGTCGGC
CTATCTGTTGTTATGGGCTGTAAAGCAGCTGGAGCAGCCAGAATCATTGC
TGTGGACATCAACAAGGACAAATTTGCAAAGGCTAAAGAGTTGGGTGCCA
CTGAATGCATCAACCCTCAAGACTACAAGAAACCCATTCAGGAAGTGCTA
AAGGAAATGACTGATGGAGGTGTGGATTTTTCGTTTGAAGTCATCGGTCG
GCTTGACACCATGATGGCTTCCCTGTTATGTTGTCATGAGGCATGTGGCA
CAAGTGTCATTGTAGGGGTACCTCCTGATTCCCAGAACCTCTCAATAAAC
CCTATGCTGCTACTGACTGGACGCACGTGGAAAGGAGCTATTTTTGGAGG
CTTTAAGAGTAAAGAATCTGTCCCCAAACTTGTGGCTGACTTTATGGCTA
AGAAGTTTTCACTGGATGCATTAATAACAAATATTTTACCTTTTGAAAAA
ATAAATGAAGGATTTGACCTGCTTCGCTCTGGAAAGAGTA
Bioinformatics group AgroBioInstitute
2Whos in it?
- 2 Assoc. professors
- Dimitar Vassilev, PhD Group leader,
bioinformatics, statistics, quantitative
genetics, genome research - George Dimov, PhD population genetics
- 4 PhD students
- Ivan Popov prediction of protein structures,
genome analysis, phylogenetics - Irena Avdjieva genome assembly and synteny
- Milko Krachunov (FMI co-supervision) Error
detection in NGS, metagenomics, bio-ontologies - Valeria Simeonova (FMI co supervision) soft
computing, NGS data analysis - Several MSc students
3Projects
- Financed by the Agricultural Academy
- Contemporary biotech approaches for the
preservation of biodiversity and selection in
plant and animal breeding 2009-2010. - Prof. Rossitza Batchvarova
- Financed by the NSF and the Ministry of Education
Youth and Science - Center for sustainable development of plant and
animal genomics (EXELLENCE IN BIOECONOMY)
(CESBD) 2009-2012 - prof. Atanas Atanassov
- Analysis of anti-microbial and anti-cancer
bioactive products from marine organisms
2008-2011 Asoc. Prof. P. Dolashka IOC BAS - Research of the molecular mechanisms of drought
stress in grain cultures, 2008-2011 ABI College
of Agronomy and Biotechnology, China Agricultural
University, Beijing (CHINA)
4Projects
- Financed by the 7 Framework Programme, EU
- Genetic and physiology of wheat development to
flowering tools to breed for improved adaptation
and yield potential (ADAPTAWHEAT) 2011-2015
Project leader Dr. Simon Griffiths John Ines
Centre, Norwich, UK ABI coordinator Dr. Elena
Todorovska Dr. Dimitar Vassilev, Prof. Atanas
Atanassov - Public Perception of Genetically modified
Animals Science, Utility and Society
(PEGASUS)FP7 KBBE 2008 1, 2009-2012 Project
leader Lynn Frever (DSS Wageningen University,
The Netherlands) ABI coordinator Prof. Atanas
Atanassov, Dr. Georgi Dimov - COST Action ??1006 Next Generation Sequencing
Data Analysis Network" 2011-2015 MC member from
ABI Dr. Dimitar Vassilev - COST ActionTD0801 Statistical challenges on the
1000 genome sequences in plants (StatSeq)
2009-2013 MC member from ABI Dr. Dimitar
Vassilev - COST Action BM 0702 European Kidney and Urine
Proteomics (EuroKUP) WG4 Bioinformatics for
protein analisys 2008-2012 MC representative
from ABI Dr. Dimitar Vassilev
5Group publications 2010
- Georgieva, M., Stoilov L., Rancheva,
E.,Todorovska, Vassilev D. (2010) Comparative
analysis of data distribution patterns in plant
commet assay. Biotechnology and Biotechnological
Equipment 24(4)2142-214 - Vassilev D., Dimov, G., Popov I., Atanassov A.
Bioinformatics research and perspectives in the
AgroBioInstitute. Biotechnology and
Biotechnological Equipment 24(4)2172-2176 - Vukovic V., Andonov, S., Vassilev, D., Trpkovski
Z., Murdzeva A-M. (2010) Improved classification
results for macedonian pork , In Proc 9WCGALP,
Leipzig, Germany pub. 846. - Petrov P., van Ophuizen E., Leunissen J.,
Krachounov M., Popov I., Vassilev D. (2010)
AnatOntoMerger a system for computer-aided
merging of anatomical ontologies, In Book of
Abstarcts Workshop of COST action BM0702
European Kidney and Urine Proteomics (EuroKUP),
meeting, Cyprus, 6-7 November. - Popov I., Vassilev D. (2010) A semi-automated
structural class independent method for the
prediction of protein secondary structures.
Biotechnology and Biotechnological Equipment
24(3) 2044-2048 - Todorovska E., Atanassov A., Vassilev D. (2010).
From genetics to genomics in plants and animals.
Acta Yugoslavia Genetika, vol. 42, no. 1,
177-194. - ??????? ?. (2010) ?????????????? ??????,
?????????? ? ??????????? ?? ???????????? ? ?
??????????, ???. 180-193, ? ?????????? ????????
? ???????? ??? ?????????? ?? ????. ?????
???????. (??????????). - Popov I., Vassilev D., Attwood T. (2010) Building
diagnostic fingerpints for important kidney
membrane proteins the aquaporins (STSM results).
In Book of Abstarcts Workshop of COST action
BM0702 European Kidney and Urine Proteomics
(EuroKUP), Rotterdam, The Netherlands 20-21 March
2010. - Todorovska E., Kolev S., Ganeva G., Christov N.,
Vassilev D. (2010) Allele variation in loci for
adaptive response and yield traits in Bulgarian
wheat. In Book of Abstarcts of 2nd International
Symposium on Genomics of Plant Genetics Resources
(GPGR), p.218 (P5.32), Bologna, Italy, 24-27
April 2010. - Popov I., Simeonova V., Vassilev, D. (2010)
Estimation of sequencing error rates in the
database sequences of the Oryza Sativa (japonica
cultivar group) genome. 2nd workshop of EU COST
action TD0801 Statistica challenges on the 1000
genome sequences in plants (StatSEQ), Het Pand,
Univ. of Ghent, Ghent, Belgium, May 20-21, 2010.,
p.34.
6Services and productsWeb based information
system for control of milk productivity and
cattle selection ISKRA George Dimov, PhD
- Main modules
- Data management,
- reports current and summarized
- error checking and validation
- ISKRA includes 12 regions
- gt600 farms
- about 22 of milk giving cows
- Services and reports
- Regional selection offices
- Breeding organizations
- Farmers advice and management
- Development though 2011
- Feeding and breeding advice
- market information
- breeding values
- reproduction management
7Group development
- Collaborative projects in 7FP, ?UROSTARS and
other financing tools - Main topics
- NGS data analysis
- Biological ontologies
- Modeling protein structures
- Information resources for agriculture
production management - Population and associative genome studies
- GMO detection and data analysis
- Software development
-
8Group collaborations
- In Bulgaria
- Faculty of Mathematics and Informatics, Faculty
of Biology, Sofia University - Joint Genomic Center
- Agricultural University, Plovdiv
- Thracian University, Stara Zagora
- Medical University, Sofia
-
- Abroad
- - Wageningen University The Netherlands
- - Roslin Institute University of Edinburgh,
Scotland, UK - - John Innes Centre, BBSRC, Norwich, UK
- - INRA France
- - Agricultural University Athens
- - European Bioinformatics Institute and EMBL,
- - Max Plank Institutes
- - CAU, ?????
- - IBB, Poland
9Other group activities
- Bioinformatics seminars informal meeting for
discussion and collaboration - With foreign Bioinformatics groups
- Co-supervision and consultations of MSc an PhD
students - Attendance and organization of International
courses - - ICGEB Course in Bioinformatics, Trieste
- - 2011 October 3 day course on Bioinformatics
in genomics and metabolomics with speakers from
EBI, EMBL, Hinxton
10Thank you for your attention!
10