Title: DNA and Genes
1DNA and Genes
2Thing to find out
- What is DNA?
- The Genetic code
- The Human genome
- Passing on the genomic information
- Inheritance patterns
3Diversity of Life
- All biological systems are composed of the same
types of molecules - Similar organization priciples are used at the
cellular level
4The Cell
- Basic component of life
- Two main categories, prokarytic and eukaryotic
cells - Differences in the nucleus
5- Prokaryotes lack a defined nucleus and have a
simplified internal structure - Eukaryotes have membrane limited nucleus and more
complicated internal structure - Three branches of life
6- Genetic material is located to the nucleus
- The genetic information is stored in
Deoxyribonucleic acid, DNA - DNA contains all the information needed to build
an individual
7What is DNA needed for?
- Genetic information
- is used for gene expression
- Information of a gene is
- transferred from DNA and
- converted to protein
- RNA molecules work as messangers
- Proteins are the biological workers
8- Information of the DNA is copied by
- directing the synthesis of a RNA molecule
- in a process called transcription
-
- RNA directs the protein synthesis in a
translation - Proteins 3D structure determines its function
- Information can transfer only in one direction
9DNA (Deoxyribo Nucleic Acid)
- DNA is a polymer of nucleotide monomers
- 2-deoxyribose sugar
- Four bases
- Adenine, A
- Guanine, G
- Thymine, T
- Cytosine, C
Base part
- Together a sugar and
- a base are called
- a nucleoside
Sugar part
10Four bases...
- Pyrimidine bases
- Thymine and cytosine
- A single carbon ring
- Purine bases
- Adenine and guanine
- Two carbon rings
11 DNA chains
- Nucleosides are joiden together with
phospsodiesteri bond - Sequence of bases vary ? genetic information
- Chains are extremely long!
12 DNA Molecules
- DNA molecules are composed of two polynucleotide
chains - Double helix, twisted in right handed way
- Twists a full circle in every 10 bases
13- ladder-structure
- Bases steps
- Sugars and phosphates suporting pilars
- Two nucleotide chains run in opposite
directions ? chemical direction
14 Complementary Pairing
- Bases interact with other bases
- Purines with two carbon rings interact only with
single ring pyrimidines ? Space between the
chains is limited. - A ? T
- G ? C
- Complementary pairing ? Vital for retainins of
the genetic information!
- Interaction is stabilized by hydrogen bonds
- A-T bond ? two hydrogen bonds
- G-C bond ? three hydrogen bonds
15The Genetic Code
- Describes how base sequences are converted to
protein sequence - DNA sequence is divided into series of units of
three bases ? a codon - One codon is spesific to one amino acid (
structural component of protein)
16- The four bases can form 64 codons
- 20 amino acids are found from the nature
- Codons hava also alternative functions needed to
regulate protein synthesis
17- Right reading frame is obligatory!!!
- Sequence of human HCR gene, which assosiates with
psoriasis
atgtttccac cttcaggttc cactgggctg attcccccct
cccactttca agctcggccc ctttcaactc tgccaagaat
ggctcccacc tggctctcag acattcccct ggtccaaccc
- Many different reading frames can be used, but
only one is the right one - Transleate tools can found form the internet
Frame 1 Met F P P S G S T G L I P P S H F Q A R P
L S T L P R Met A P T W L S D I P L V Q Frame
2 C F H L Q V P L G Stop F P P P T F K L G P F Q
L C Q E W L P P G S Q T F P W S N Frame 1 G L
D Q G N V Stop E P G G S H S W Q S Stop K G P S L
K V G G G N Q P S G T Stop R W K H
The right one
18Genes
- Genetic information is encoded in the base
sequence of the DNA - A gene DNA sequence that encodes amino acid
sequence of a protein - Beside the coding area, also other elements are
needed ? control elements and empty areas
19- Genes vary a lot in size
- Genes are separeted from each others by sequences
which function is unknown - Only other strand of the DNA carries biological
information ? template strand - Potential to store biological information is
enormous
20Chromosome
Condenced scaffold
fibers connected to chromosome scaffold
chromatin fibers
chromatin
DNA
21Mutations
- Mutations are alterations in DNA sequence
- Many chemical and physiological agents
- and errors in DNA replication
- Cells can repaire some mistakes
- Once introduced and not repaired,
- changes in DNA sequence are
- made permanent by DNA replication
22Sequence variations
- Single nucleotide polymorphims
- Alteration of a single base ?
- 1. Causes an alteration in the amino acid that
the codon codes - 2. Does not cause alteration on the amino acid
that the codon codes - 3. Alters codon in the way that it becomes
stop-codon for protein synthesis
23- Frameshift mutation insertion/deletion of bases
? reading frame is alterered
24The Human Genome
The different types of sequences that make up
the total DNA of a human cell
25The Human genome...
- 3 billion base pairs
- about 30000 genes
- 23 chromosome pares ? 46 chromosomes
- 25 of the DNA is gene related
- Only 5 encodes proteins
- Genes include exons and introns
- Beside coding areas also additional secuences
are found
26Two important terms... Phenotype The outlook
of an organism Genotype The genetic information
written in the DNA
Phenotypes
Genotype
Genotype
GCCAAGAATGGCTCCCACCT GGCTCTCAGACATTCCCCTGGTCCAACCC
CCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCA
AGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA
ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTCC CACTTT
CAAGCTCGGCCCCTT TCAACTCAGAGAGGCGGCTA GACACCCAGAGAC
CTCAAGT GACCATGTGGGAACGGGATG TTTCCAGTGACAGGCAG
27Passing on the genetic information
- Information passed on in the sexual reproduction
- Needed for new characteristics to develope
28- All somatic cells
- 46 chromosomes
- Diploid cells, 2n
Fertilization
n n
- Sperm cell
- 23 chromosomes
- Haploid cell, n
- Egg cell
- 23 chromosomes
- Haploid cell, n
- Fertilized egg
- 2n
- 46 chromosomes
29- Mitosis
- Every cell division
-
- The number of chromosomes
- does not change
- DNA dublicates before entering
- the mitosis
- Takes 1-2 hours
30- Meiosis
- Nuclear division
- Only in gamete formation
- Results formation of the haploid
- gametosytes
- Mature gametocytes have 23
- chromosomes (n)
31(No Transcript)
32- Humans
- 46 chromosomes ( 44 autosomes, 2 sex chromosomes)
- X and Y chromosomes
- XX ? female
- XY ? Male
33(No Transcript)
34(No Transcript)
35The chromosome pare
- A locus
- An allele
- Heterozygous (Aa)
- Homozygous (AA or aa)
36- We have two copies of each gene, one from the
mother - and one from the father ? Genotype
- Dominant character only one allele needed to
cause the - phenotype (heterozygous)
- Recessive character both allels needed to cause
the - phenotype (homozygous)
37Inherited diseases
- DNA mutations are significant in development of
diseases - Inherited diseases are caused by mutations
passed from - a parent to a offspring
- Monogenic diseases disease is caused by
mutation in - one gene
- Multifactioria diseases disease is caused by
co-operative - action of different mutations in different genes
and - environmental factors
- Mendelian inheritance Presence or absence
depends of the genotype at the single locus
38(No Transcript)
39Autosomal dominant inheritance
40Autosomal recessive inheritance
41X-chromosome linked recessive inheritance
42X-chromosome linked dominant inheritance
43(No Transcript)