Title: Biology 107 Macromolecules III
1Biology 107Macromolecules III
2Proteins May Be Denatured and Renatured.
When proteins are changed from one environment
to another they usually change shape (denature).
Return to the original environment commonly
results in folding that is different than
normally found under that condition.
3Protein Partners (Chaperones) Influence Folding
4Protein Chaperones Influence Correct Folding
5Macromolecules III
- Student Objectives As a result of this lecture
and the assigned reading, you should understand
the following - 1. Nucleic Acids are polymers of nucleotides.
There are two types of nucleic acids
deoxyribonucleic acid (DNA) and ribonucleic acid
(RNA). - 2. Nucleic acids function in information coding,
storage and transfer. DNA does not directly
control protein synthesis, instead it works
through intermediates, RNA molecules. -
-
6Macromolecules III
- Each nucleotide monomer has three (3) parts
- five carbon sugar
- phosphate group
- nitrogenous base
- Nucleic acids contain one of two 5-carbon
sugars, either deoxyribose (in DNA) or ribose (in
RNA). Linked to the one end of the sugar is a
phosphate group, and linked to the other end of
the pentose is one of the nitrogenous bases. DNA
has the nitrogenous bases adenine (A), guanine
(G), thymine (T), and cytosine (C). RNA has A, G,
C and uracil (U) (instead of thymine).
7Macromolecules III
- A nucleic acid polymer, a polynucleotide, forms
from monomers covalently linked by dehydration
synthesis. The phosphate group of one nucleotide
bonds to the sugar of the next nucleotide, with
the result a repeating sugar-phosphate backbone. - RNA is normally a single polynucleotide strand,
while DNA is a double-stranded molecule. - Nucleic acids form complementary base pairs
stabilized by hydrogen bonds, with guanine
pairing with cytosine and adenine pairing with
thymine or uracil. -
8Functions of Nucleic Acids
Information coding, storage, and
transfer Synthesis of other nucleic acids or
proteins Central Dogma DNA ? RNA ? Protein
9The Flow of Genetic Information (The Central
Dogma)
10We store lots of information using simple linear
codes
Mass Storage of Information
11CTGGGTTCTGTTCGGGATCCCAGTCACAGGGACAATGGCGCATTCATATG
TCACTTCCTTTACCTGCCTGGAGGAGGTGTGGCCACAGACTCTGGTGGCT
GCGAACGGGGACTCTGACCCAGTCGACTTTATCGCCTTGACGAAGGGTTG
GTTAATCCGTGCATGTGAGCTCCTCAGGGTGGAATCCAGGAGGATCCACG
AGGGTGAATTGGCGGCATTCTTGTCTTACGCCATCGCCTACCCCCAAAAC
TTCCTGTCTGTGATTGACAGCTACAGCGTAGGATGCGGTCTGTTGAACTT
CTGCGCGGTGGCTCTGGCTCTCTGTGAACTGGGCTACAGGCCTGTGGGGG
TGCGTTTGGACAGCGGTGACCTCTGCAGCCTGTCGGTGGATGTCCGCCAG
GTCTTCAGACGCTGCAGCGAGCATTTCTCCGTCCCTGCCTTTGATTCGTT
GATCATCGTCGGGACGAATAACATCTCAGAGAAAAGCTTGACGGAGCTCA
GCCTGAAGGAGAACCAGATTGACGTTGTCGGAGTCGGAACTCACCTGGTC
ACCTGTACGACTCAGCCGTCGCTGGGTTGCGTTTACAAGCTGGTGGAGGT
GAGGGGGAGGCCCCGGATGAAGATCAGCGAGGATCCGGAAAAGAGCACCG
TTCCCGGGAGGAAGCAGGTGTACCGCCTGATGGACACTGATGCTCCTCCA
GAACCTGGAGTCCCTCTGAGCTGCTTCCCTCTGTGCTCCGATCGCTCCTC
CGTCTCCGTCACCCCGGCGCAGGTTCACCGTCTGCGGCAGGAAGTCTTTG
TTGATGGACAGGTCACAGCCCGTCTGTGCAGCGCCACAGAGACCAGAACG
GAGGTCCAGACCGCTCTCAAGACCCTCCACCCTCGACACCAGAGGCTGCA
GGAGCCAGACTCGTACACGGTGATTCACATTCTGAAGAAAACAACATTGG
ATCGCGCTTTTCCGCTCTCTTCCCTTAGTTTCCCCTCCGAACTCCGCCGC
TGGGCCGGAGGACTGAACCGGCCCCCGACGGTGTCCCAGCGGCGGTGCAA
TGTGGCCCGGGTCCGGGAGGAGTGCGTGACGCCAGAGCAGAATGGTTCGG
TGGACGGGGGCGCACACGCTTCTCGCCGCGGCCGCTCCCCGCGGCCCACG
GAACCGCGGGATCGGAGCTGTTTTGTGCCGCCTGAAGGACTCGAAGGGGG
ACGGATAAATGCTGGATCCCCGAGTCCAGATCTGACCGTCTGCATTCCGC
TGGTGAGCTGCCAGACGCATCTGGAAACGAGCGCCGACAGAAGCAGCTCC
GGACCATGTCGCCGTCCGCGCACACAGGTCGCGTGTAAAGGGGACTTGGT
CAGATCATCTTGCACCGGAACCAGGTCTCCCCTGGAGATGGGGACGGTCA
TGACCGTCTTCTACCAGAAGAAGTCCCAGCGGCCGGAGAGGAGAACCTTC
CAGATCAAGCCTGACACGCGGCTCCTCGTGTGGAGCCGAAACCCCGACAA
AAGCGAAGGAGAGAGTGAGTATGAGCAGGCGGGCCGTGCCGGGACCGGGC
CCACGCCGCCCAGAACCTCATGTTCCTGGTGTTCCAGCACCGACCGGCCA
GTTCTGGCTCAGCTCCACACAACATCTGACAAACCCTCGTGGTTCCTGGT
GGTCGACCACACGGCTGGTGAGGCGGCCTCAGGTAGCTCAGGTAGCTCAG
GTTAGCGTAAAGGGAGTTTTAAGCATCACCTGGTGACGGGGCAGGTGAGC
TCCAGCCACTCAGCAGTGCACGGCCGTGCACATACACACACACCTCTGTG
TCGAGGTTACAGGTGGGGCCAAAGCCCAACACCTTCAATGGCCCTCAGAG
CTTTGAGGTTTTGAGGAATTGAGCCTTTAATCAGAAAA
Mass Storage of Information
Another simple linear code, the DNA sequence, is
the basis of life
12Dense Information Storage
- This image shows 1 gram of DNA on a CD that can
hold 800 MB of data. - The 1 gram of DNA can hold about 1x1014 MB of
data. - The number of CDs required to hold this amount of
information, lined up edge to edge, would circle
the Earth 375 times, and would take 163,000
centuries to listen to.
13DNA as Mass Storage Device
If the DNA sequence from a single human sperm
cell were typed on a continuous ribbon in
ten-pitch type, that ribbon could be stretched
from San Francisco to Chicago to Washington to
Houston to Los Angeles, and back to San
Francisco, with about 60 miles of ribbon left
over.
14Structure of Nucleotides
15Structure of Nucleotides
Pentose sugar Phosphate group Nitrogenous base
16Nitrogenous Bases
17Chargaffs Rules
Erwin Chargaffs data indicated that in DNA the
amount of adenine nearly always equaled the
amount of thymine and the amount of cytosine
nearly always equaled the amount of guanine.
Source mol of bases mol of bases mol of bases mol of bases  Ratios  Ratios  GC
Source  A  G  C  T  A/T  G/C  GC
 Octopus  33.2  17.6  17.6  31.6  1.05  1.00  35.2
 Chicken  28.0  22.0  21.6  28.4  0.99  1.02  43.7
 Rat  28.6  21.4  20.5  28.4  1.01  1.00  42.9
 Human  29.3  20.7  20.0  30.0  0.98  1.04  40.7
18Double Helix Structure of DNA
1953
2003
Original Nature paper by Watson and Crick
1953 Click to Open
19Thread of History
Back in my rooms I lit the coal fire, knowing there was no chance that the sight of my breath would disappear before I was ready for bed. With my fingers too cold to write legibly I huddled next to the fireplace, daydreaming about how several DNA chains could fold together in a pretty and hopefully scientific way. Soon, however, I abandoned thinking at the molecular level and turned to the much easier job of reading biochemical papers on the interrelations of DNA, RNA and protein synthesis.
 from Chapter 21 of The Double Helix by James Dewey Watson.
20Thread of History
Virtually all the evidence then available made me believe that DNA was the template upon which RNA chains were made. In turn, RNA chains were the likely candidates for the templates for protein synthesis. There was some fuzzy data using sea urchins, interpreted as a transformation of DNA into RNA, but I preferred to trust other experiments showing that DNA molecules, once synthesized, are very very stable. The idea of the genes' being immortal smelled right, and so on the wall above my desk I taped up a paper sheet saying DNA -gt RNA -gt protein. The arrows did not signify chemical transformations, but instead expressed the transfer of genetic information from the sequences of nucleotides in DNA molecules to the sequences of amino acids in proteins.
 from Chapter 21 of The Double Helix by James Dewey Watson.
21The Eagle
22Questions to Consider For Watson and Crick Paper
- What was one of the reasons Watson and Crick did
not expect the phosphate groups in DNA to be
aligned along the axis of the DNA molecule? - What is the means by which the individual strands
in DNA are joined together? - What is the consequence of knowing the base
sequence of one strand? What is the implication
for copying the genetic material?
23DNA Is Normally Double-Stranded
Each strand has polarity (5 and 3 ends). In
double-stranded DNA each strand is oriented
anti-parallel to the other strand. The strands
are normally held together by hydrogen
bonds. The optimal hydrogen bonding is when A
bonds with T and G bonds with C.
24Base Pairing in DNA
G/C pairs have three hydrogen bonds A/T pairs
have two hydrogen bonds
25Double Helix
26Nucleic Acid Gel Electrophoresis
27The Sequence of Nucleotides Encodes Information
_
28 The Double Helix Structure of Complementary
Strands Explains The Mechanism of DNA Replication
29ATP Is a Nucleotide
30ATP Structure and Hydrolysis
31Summary of Adenine Phosphates
1. ATP (adenosine triphosphate) 3 phosphate
groups adenine ribose sugar a. This is the
high energy form b. The energy is greatest in
the bond holding the third phosphate - that bond
is easily broken. 2. ADP (adenosine diphosphate)
2 phosphate groups adenine ribose sugar a.
This is the low energy form b. ADP can be
recharged into ATP by addition of phosphate, if a
phosphate source and enough energy are
available. 3. AMP (adenosine monophosphate) 1
phosphate group adenine ribose sugar a.
Intracellular activator of processes
32Additional Resources
http//www.nature.com/nature/dna50/ - Anniversary
issue of Nature celebrating the 50th year
following the original DNA structure articles.
Interesting links. Article about Rosalind
Franklin. http//www.genome.gov/10001772 -
Federal Human Genome Project website. http//www.
time.com/time/time100/scientist/profile/watsoncric
k.html - short recount of Watson and Crick at
Cambridge. http//www.dnai.org/index.htm - Home
page for DNA Interactive. Time lines and
interesting historical information. Photos at
http//www.dnai.org/album/6/album.html.