Open Reading Frames and Gene Splicing

1
Open Reading Frames and Gene Splicing
2
Open Reading Frames

• Different Reading Frames
• AUGUAUGAAUCUGGUGAAUGUUAUUGGUGUGAAUUGAUAUUAGGUAUUGG
  UUGA
• AUGUAUGAAUCUGGUGAAUGUUAUUGGUGUGAAUUGAUAUUAGGUAUUGG
  UUGA
• AUGUAUGAAUCUGGUGAAUGUUAUUGGUGUGAAUUGAUAUUAGGUAUUGG
  UUGA

• Because genetic information is encoded groups of
  nucleotides, its not clear whether to begin
  translation at the first, second, or third
  nuceotide.
• Because of this, Genes contain 3 different
  reading frames
• A stop codon can occur at any point in the gene
  and not necessarily be read as a stop codon.
• A possible gene would be one that starts with a
  start codon (AUG) and ends with a stop codon
  (UGA)
• Since genes are usually much longer than 50
  codons, computer software can be used to search
  for the longest possible genes
• In a particular segment of RNA, the longest gene
  stretch is likely the correct Open Reading frame

3
Introns and Exons

• Eukaryotic genes contain significantly more base
  pairs than the mRNA required for protein
  synthesis
• Introns consist of the Intervening nucleotides
  that must be removed before translation
• Exons consist of the Exhibited nucleotides that
  must be spiced together for translation to proceed

4
What is a spliceosome?

• A complex RNA and many protein subunits, that
  remove the non-coding introns from unprocessed
  mRNA, through a process called RNA splicing.
• Only occurs in eukaryotes

5
Process of RNA Splicing

• RNA Splicing occurs in the nucleus
• There are specific 5' and 3' sites on the
  pre-mRNA that the spliceosome recognizes.
• Introns begin with the nucleotides of guanine,
  thymine and end with adenine, guanine, known as
  GT-AG Rule.
• Introns are removed from the sequence and exons
  are joined back together.
• RNA splicing occurs in order to delete the
  interrupting base sequence, so that it is able to
  code for a protein.
• If the introns are not removed, the RNA would be
  translated into a nonfunctional protein.

6
What is alternative splicing?

• Different RNA splicing mechanism in which results
  in exons either being retained or targeted to
  remove to created alternate RNA arrangement in
  mature mRNAs.
• Purpose is to allow more than one distinct
  protein to be produced from a single gene
• Increase cellular diversity (give rise to new
  proteins)
• Some types of alternative splicing
• Intron retention intron is retained in the mRNA
  and codes for an amino acid
• Exon skipping exon is spliced out in the mRNA

7
Example of Alternative Splicing

• Alternative splicing in the human body
• Alternative splicing causes five different
  versions of tropomyosin, a structural protein,
  which are produced in 5 different tissues
  skeletal and smooth muscle, fibroblast, the brain
  and the liver.
• 11 of the tropomyosin gene are spliced
  differently, producing different forms of the
  protein to create the different tissues in the
  body

8
Splicing Mechanism Ribozymes

• What is a Ribozyme?
• RNAs that are capable of splicing themselves
• Intron is the source of enzymatic activity
• No additional component required for splicing
• Ex. Introns that are part of the primary
  transcript of rRNAs

• Self- Excision Process

http//themedicalbiochemistrypage.org/group1splici
ng.jpg
9
SnRNPs Role in Splicing

• What are snRNPs?
• Small nuclear ribonucleoproteins
• Small nuclear RNAs (snRNAs) combine with snRNPS
  to form the spliceosome
• Most common are U1, U2, U3, U4, U5, and U6

• SnRNPs role
• Provides catalytic activity
• Recognize certain sequences in introns
• Ex. GU region on the 5 splice donor sequence on
  the end on the intron
• Intron sequence is released as a lariat
• Exons are ligated together
• Leads to mature mRNA

10
SnRNPs Role in Splicing
http//www.ncbi.nlm.nih.gov/books/bv.fcgi?callbv.
View..ShowSectionridcell.figgrp.1709
http//www.youtube.com/watch?vFVuAwBGw_pQ