Title: Principles of Pathogenesis Bacterial Infection
1Principles of PathogenesisBacterial Infection
- Professor Mark Pallen
- University of Birmingham
2Microbes and humans
Very few microbes are
always pathogenic
Many microbes are
potentially pathogenic
Most microbes are
never pathogenic
3Microbes and humans
- Disease can come about in several overlapping
ways - 1. Some bacteria are entirely adapted to the
pathogenic way of life in humans. They are never
part of the normal flora but may cause
subclinical infection, e.g. M . tuberculosis - 2. Some bacteria which are part of the normal
flora acquire extra virulence factors making them
pathogenic, e.g. E. coli - 3. Some bacteria from the normal flora can cause
disease if they gain access to deep tissues by
trauma, surgery, lines, especially if associated
with a foreign body, e.g. S. epidermidis - 4. In immunocompromised patients many free-living
bacteria and components of the normal flora can
cause disease, especially if introduced into deep
tissues, e.g. Acinetobacter
4How do we know that a given pathogen causes a
specific disease?
- Koch's postulates
- the pathogen must be present in every case of the
disease - the pathogen must be isolated from the diseased
host grown in pure culture - the specific disease must be reproduced when a
pure culture of the pathogen is inoculated into a
healthy susceptible host - the pathogen must be recoverable from the
experimentally infected host
5The iceberg concept of infectious disease
poliomyelitis in a child
0.1-1 of infections are
clinically apparent
classical
clinical disease
less severe
disease
rubella
50 of infections are
clinically apparent
asymptomatic infection
Spectrum of virulence
rabies
100 of infections
are clinically apparent
6How do we know that a given pathogen causes a
specific disease?
Diagnosis and effective treatment of infection
depends not just on isolating an organism, but in
establishing a plausible link between the
laboratory findings, recognised syndromes and the
patient's clinical condition
Recognised syndromes
e.g.
septicaemia, endocarditis,
osteomyelitis meningitis,
UTI, pneumonia
pharyngitis
patient's clinical condition
potential pathogen isolated from or detected in
clinical samples
7Microbes and humans
- Evidence for a potential pathogen being clinical
significant (particularly for bacteria) - Isolated in abundance
- Isolated in pure culture
- Isolated on more than one occasion
- Isolated from deep tissues
- Evidence of local inflammation
- Evidence of immune response to pathogen
- Fits with clinical picture
8Normal flora
- All body surfaces possess a rich normal bacterial
flora, especially the mouth, nose, gingival
crevice, large bowel, skin - This can be a nuisance in that
- it can contaminate specimens
- it can cause disease
- This is beneficial in that
- it can protect against infection by preventing
pathogens colonising epithelial surfaces
(colonisation resistance) - removal of the normal flora with antibiotics can
cause superinfection, usually with resistant
microbes - Endogenous viruses reside in the human genome
- worries about similar pig viruses in xenografts
9Bacterial Virulence A simplistic view
- Some bacterial proteins (exotoxins) can elicit
the features of a bacterial infection when
injected as pure proteins, e.g. - tetanus toxin, botulinum toxin
- diphtheria toxin, anthrax toxin
- Vaccination with inactivated toxins (toxoids)
led to a spectacular decline in the incidence of
many bacterial infections. - Leading to the simplistic idea that all bacteria
need to cause disease is a single toxin
10Bacterial Virulence A more sophisticated view
- There are many different ways to define a
virulence factor - needed to colonise and/or damage tissues
- Molecular Kochs postulates
- Delete gene, show loss of virulence in model
system, add gene back (e.g. on plasmid), show
restoration of virulence - Biochemical evidence of damaging potential
- distinguishes pathogen from commensal
- Comparative genomics
- expressed or essential in vivo
- but not in the lab?
11Bacterial Virulence A more sophisticated view
- Virulence as a process is
- MULTIFACTORIAL
- A bacterial army, like a human army, needs more
than just its firearms to enter and secure enemy
territory - An army marches on its stomach Napoleon
- MULTIDIMENSIONAL
- A programme of events organised in time and space
12Steps in successful infection
- Sex comes before disease
- acquire virulence genes
- Sense environment
- and Switch virulence genes on and off
- Swim to site of infection
- Stick to site of infection
- Scavenge nutrients
- especially iron
- Survive stress
- Stealth
- avoid immune system
- Strike-back
- damage host tissues
- Subvert
- host cell cytoskeletal and signalling pathways
- Spread
- through cells and organs
- Scatter
13Bacterial Sex acquiring virulence genes
- Bacteria have three ways of exchanging DNA
- Transformation
- cells take up naked DNA
- Transduction
- phages carry DNA
- Conjugation
- cells mate through specialised appendages
14Bacterial Sex Mobile genetic elements
- Transposons
- ST enterotoxin genes
- Virulence Plasmids
- e.g. TTSSs in Shigella, Yersinia toxins in
Salmonella, E. coli, anthrax - Phage-encoded virulence
- e.g. botulinum toxins, diphtheria toxin,
shiga-like toxin (linked to lysis),
staphylococcal toxins, TTSS substrates in
Salmonella.
15Bacterial Sex Pathogenicity Islands
- Concept originated from study of uropathogenic E.
coli strains - Defining Features
- Carriage of (many) virulence genes
- Presence in pathogenic versus non-pathogenic
strains - Different GC content from host chromosome
- Occupy large chromosomal regions (10-100 Kb)
- Compact distinct genetic units, often flanked by
DRs, tRNAs, ISs - Presence of (cryptic) mobility genes
- Unstable, prone to deletion
16Bacterial Sex Pathogenicity Islands
- often encode secretion systems
- LEE region in EPEC
- Spi1, Spi2 in Salmonella
- Cag in H. pylori
- can also encode adhesins, siderophores, toxins
- Uropathogenic E. coli (Pai I, II, IV, V)
- Yersinia spp. (HPI)
- V. cholerae (VPI or TCP-ACF element)
17Sense environment
- Bacteria can sense changes in environment
- e.g. in temperature, nutrient availability,
osmolarity, cell density (quorum sensing). - In simplest cases, change in intracellular
concentration of ion linked directly to gene
expression - e.g. fall in intra-cellular iron levels triggers
de-repression of diphtheria toxin gene - In more complex cases, sophisticated signal
transduction cascades allow bacteria to regulate
gene expression in response to environmental cues - the pathogen as an information processor
18Switch virulence factors on and offA
multi-layered hierarchy
- Changes in DNA sequence
- Gene amplification
- Genetic rearrangements
- e.g. Hin flip-flop control of flagellar phase
variation - Transcriptional Regulation
- Activators and Repressors
- (helix-turn-helix motif)
- mRNA folding and stability
- Translational Regulation
- Post-translational Regulation
- Stability of protein, controlled cleavage
- Covalent modifications
- e.g. phosphorylation in two-component
sensor-regulator systems
19Swim
- Many bacterial pathogens are motile
- Enterics, Campylobacter, Helicobacter,
spirochaetes - Motility crucial for virulence in some cases
- Usual organelle of motilityflagellum
- Variants
- Twitching motility
- Swarming
20Stick
- To avoid physical and immunological removal,
bacteria must adhere to - cell surfaces and extracellular matrix
- e.g. in respiratory, gastrointestinal and
genitourinary tracts - solid surfaces
- e.g. teeth, heart valves, prosthetic material
- other bacteria
- Direct interaction
- Molecular bridging via e.g. fibronectin
- Adherence often combined with manipulation of
host cell signalling and cytoskeleton - Invasion
- Intimate adherence
21Stick
- Common adherence mechanisms
- Capsules and slime
- Biofilm formation
- Gram-positive adhesins
- MSCRAMMs (microbial surface components
recognizing adhesive matrix molecules), e.g.
protein A - Fimbriae
- Gram-negative adhesins (CHO and protein
receptors) - Fimbriae, Afimbrial adhesins (FHA, Pertactin
etc.) - Outer Membrane Proteins
- Types III-IV secretion
22Stick
23Scavenge nutrientse.g. iron
- Free iron levels very low in body fluids
- Acute phase response causes further drop
- Iron overload increases susceptibility to
infection - Many different bacterial systems for scavenging
iron - Siderophores chelate available iron transport
it into bacteria - Iron can be scavenged direct from host
iron-binding proteins, e.g by lactoferrin-binding
proteins - Often co-ordinately regulated e.g. by fur locus
in E. coli - Some pathogens avoid the problem by cutting out
need for iron, e.g. Treponema pallidum - Iron used to regulate aggressive virulence
factors - Diphtheria toxin (DtxR repressor)
- Shiga-like toxin
- Pseudomonas aeruginosa exotoxin A
24Survive Stress
- In addition to nutrient-limitation stress,
pathogens face many other stresses - Acid stress within stomach
- Heat shock during fever
- Oxidative stress within phagocytes
- Stress response proteins, such as chaperonins
feature as immunodominant antigens - Detoxification proteins play a role in virulence,
e.g. periplasmic Cu,Zn-superoxide dismutases - Infectious dose for enteric pathogens much lower
in achlorhydria (no need to overcome acid stress)
25Stealthavoid immune system
- IgA proteases
- metalloproteases active against IgA
- Immunoglobulin-binding proteins
- e.g. protein A of S. aureus
- Resist complement, opsonisation
- Capsule (usually polysaccharide)
- Lipopolysaccharide
- Surface proteins and OMPs
- Antigenic mimicry
- e.g. sialic acid capsule of group B meningococcus
26Stealthavoid immune system
- Antigenic or phase variation
- Involves surface structures such as proteins,
LPS, capsules - Variety of mechanisms
- slip-strand mispairing
- flip-flop
- cassettes
- Adopt cryptic niche
- inside phagocytes
- in biofilm
67700 67710 67720 GAAGTGCATTTAACTTGGGGGG
GGGGGTAAT GAAGTGCATTTAACTTGGGGGGGGGGGGTAAT GAAGTG
CATTTAACTTGGGGGGGGGGGGGTAAT GAAGTGCATTTAACTTGGG
GGGGGGGTAAT GAAGTGCATTTAACTTGGGGGGGGGGGTAAT GAAG
TGCATTTAACTTGGGGGGGGGTAAT GAAGTGCATTTAACTTGGG
GGGGGGGGGTAAT GAAGTGCATTTAACTTGGGGGGGGGGGTAAT GA
AGTGCATTTAACTTGGGGGGGGGGTAAT GAAGTGCATTTAACTT
GGGGGGGGGGTAAT GAAGTGCATTTAACTTGGGGGGGGGGTAAT
GAAGTGCATTTAACTTGGGGGGGGGGGTAAT GAAGTGCATTTAACTT
GGGGGGGGGGGGTAAT
Homopolymeric tract in Campylobacter jejuni
27Strike-back Damage host tissues
- Endotoxin
- Exotoxins
- Toxins acting on cell membranes
- Toxins active inside cells
- Superantigens
28Endotoxin of Gram-negatives
29Strike-back Endotoxin
- Actions of Endotoxin
- Pyrogenicity
- Leucopenia then leucocytosis
- Hypotension
- Gram-negative Shock
- Life-threatening complication of septicaemia
- e.g. in meningococcal infection, in ITU or
oncology patients - Endotoxic shock seen with dirty intravenous
equipment - Most of the effects of endotoxin are mediated by
tumour necrosis factor - Attempts at therapy using anti-endotoxin or
anti-TNF antibodies
30Strike-back Membrane-Damaging Exotoxins
- Many bacterial toxins form pores in eukaryotic
cell membranes, producing oligomeric rings, e.g. - streptolysin O of Streptococcus pyogenes
- listeriolysin of Listeria monocytogenes
- alpha-toxin of S. aureus
- Other toxins, such as phospholipases, degrade
components of the membrane - e.g. Clostridium perfringens alpha toxin
31Strike-back Toxins active inside cells
- Toxins often consist of translocation and binding
B subunit that delivers the active A subunit into
the host cell cytoplasm - Example of AB toxin diphtheria toxin
- an ADP-ribosyltransferase
32AB5 Toxins
33Subvert
- inject proteins into host cells to subvert the
cytoskeleton and signal-transduction pathways - manipulating e.g. Rho GTPases and the
cytoskeleton to induce membrane ruffling and
bacterial invasion - preventing uptake by phagocytic cells, e.g.
Yersinia spp. and Pseudomonas spp. - remaining within a vacuole by manipulating host
cell vesicular transport and endocytosis
34Spread
- through cells and organs
- within macrophages, e.g. in typhoid
- through blood (need to be complement-resistant)
- within cells
- actin-based motility of Listeria monocyogenes,
depends on ActA protein.
35ScatterTransmission, virulence and evolution
- Established dogmas
- balanced pathogenicity
- being too virulent is no good
- high virulence is a sign of recent emergence of a
pathogen - pathogens evolve towards symbiosis
- Counter-arguments
- Where pathogens rely on spread through biting
arthopods, high bacteraemias advantageous - Where pathogens rely on shedding into water,
highest possible shedding rates good for pathogen - Where pathogens cause incidental disease (e.g.
Legionella) no selective pressure towards low
virulence - Virulence as a local adaptation (why meningitis?)
- Bad vaccines and effect on virulence
36Summary
- Spectrum of virulence
- Commensals
- Potential pathogens
- Obligate pathogens
- Difficulties in linking pathogen to disease
- Kochs postulates
- Multi-dimensional view of virulence
- Sex
- Sense
- Switch
- Swim
- Stick
- Scavenge
- Survive stress
- Stealth
- Strike-back
- Subvert
- Spread
- Scatter
37Further Reading
- Bacterial Pathogenesis A Molecular approach,
Salyers and Whitt - (2nd Ed if possible)
- Cellular Microbiology
- Cossart, Boquet, Normark, Rappuoli
-