Pathways to Interdisciplinary Science, Engineering, and Mathematics

1
0230670 David K.
Gosser (City College) Thomas Brennan (Bronx
Community College) Manfred Philipp (Lehman
college),

The City University of New York
Pathways to Interdisciplinary
Science, Engineering, and Mathematics
- Beginning with the First Semester Peer-Led
Team Learning - Followed by a
Summer Bioinformatics Workshop -
Leads to Participation of Interdisciplinary
Research
Research Participation
Peer-Led Team Learning (PLTL)

• After completing the Summer Workshop students
  were eager to join research laboratories to work
  on bioinformatics related projects. The Pathways
  Center organized weekly group meetings for
  students to present and discuss their research.
• Research has emphasized protein structure
  analysis and modeling, microarray gene expression
  data analysis, and structural characterization of
  protein-DNA interactions, as well as
  bio-nanomaterials. Students research has led
  fruitful results which have been presented in NYC
  local and national scientific meetings, and some
  have been published in major scientific journals.
• Pathway Scholars
• - Academic year 2003-04, Ten students joined the
  research team, five working directly in the
  Pathways Center, including one 8th grade student,
  one in Biochem lab, one in organic lab, two in
  CUNY Med school and two in MSKCC.
• - Academic year 2004-05, six students working in
  the Pathways Center, and nine are in CCNY, NYU,
  MSKCC research laboratories.
• - Academic year 2005-06, fifteen new students
  joined the research training program, six work in
  the Bioinformatics Center, and six are in Biology
  Department, two in Chemical engineering at
  CCNY, and one in MSKCC research laboratories.
  

http//www.deepspace9.sci.ccny.cuny.edu
At CCNY, broad access to science is assured by
providing a supportive environment in
introductory science courses through PLTL
workshops each semester, more than 600 students
(mainly Freshman in General Chemistry)
participate in PLTL workshops. Peer-led team
learning (PLTL) is a model of learning science
that emphasizes active learning through
participation in a peer-led workshops that meet
each week for two hours and engage in discussion
and debate of scientific ideas and concepts in a
setting of small group of students. The peer
leaders, who have often just finished one or two
semesters of college work, taking a one-credit
course in group leadership, meet with faculty who
teaches the introductory courses on a weekly
basis to prepare for the workshop. Originating
at CCNY, PLTL has become a national model for
science education (http//www.pltl.org).
Participation in PLTL workshop increases student
retention and deepens understanding of scientific
concepts. PLTL helps students academically and
creates a sense of community. The faculty meeting
with the leaders each week establishes a
mentoring relationship early on. In the whole
STEP project period (2003-2005), each semester,
about 55-60 students (in CCNY) served as leaders.
40 of the leaders were newly recruited, and 54
were women, 35 under-represented minorities, and
60 were engineering majors. Peer-led
Bioinformatics We have developed a peer-led model
for teaching Bioinformatics. Students who have
completed the summer workshop can become
peer-leaders for the next workshop. Peer-leaders
assist students in learning bioinformatics tools
and in their independent projects.
Bioinformatics Workshop
The Pathways program is aimed at attracting more
promising undergraduate students to major in
STEM, and to establish a solid foundation for
their future careers. To reach the goal of the
program, we have created an institutional culture
and infrastructure that ensure students work
with faculty as a community of scholars
throughout their undergraduate experience. We
use interdisciplinary field Bioinformatics as a
unified theme to prepare STEM students with
diverse background for the following Research
training. In the whole project period (2003-2005)
we conducted three Summer Bioinformatics
Workshops (3 weeks for 2003, 4 weeks for 2004
and 2005), and three winter workshops (3 days
each). Over 120 students participated in the
workshop and Were introduced to the cutting edge
interdisciplinary research fields, Such as
molecular structural biology, molecular genetics,
gene expression profiling, and
bio-nanotechnology, etc.
Dr. Vivian Stojanoff, X6A Beam Line, BNL, Lecture
on High Throughput Protein Structure
Determination and Synchrotron Crystallography
Facility.
Hands-on computer exercises. Following two weeks
of intensive study of bioinformatics concepts and
tools, students pursue independent projects for
the next two weeks.

• Objectives
• Introduce concepts, software, and applications
  of bioinformatics.
• Provide an early exposure to interdisciplinary
  research fields.
• - Recruit students into bioinformatics related
  research projects.

• Topics
• Comparative genomics, NCBI and Genbank databases
• Online software for information retrieving and
  analysis,
• sequence analysis, phylogenetic analysis
• Statistical analysis of gene expression profile
• Structural bioinformatics SWISS-PROT protein
• RCSB protein structure database sequence
  similarity
• and homology modeling protein structure
  prediction
• and structural visualization.
• DNA recombinant technology and in silico
  cloning.
• Transcription factor, promotor and gene
  expression regulation
• RNA secondary structure, MicroRNA RNAi and gene
  silencing
• Perl Programming.

Dr. Yuying Gosser and Hai Yan Gaw, the Pathways
Scholar, who joined Dr. Patels lab in MSKCC
since summer 2004. Ms. Gaw studied the structure
of the promoter of cMYC gene using NMR
spectroscopy under the supervision of the
Research Associate Anh Tuan Phan, and their work
was published on Nature Chemical Biology (Aug.
2005)
Workshop Faculty front Alex Lash (MSKCC), Tom
Brennen (BCC), David Calhoun (CCNY), Manfred
Philip (Lehman), Shuba Govind (CCNY), Yuying
Gosser (CCNY) and David Gosser (back).
A poster session caps the workshop

The impact of Summer Workshop Students from a
variety of disciplines valued the introduction
to Bioinformatics concepts and
application. Students were empowered by Internet
knowledge database and software. Students were
highly motivated after the workshops to engage
in Bioinformatics related research and course
work such as probability and statistics. Summer
workshops increased the contact between faculty
and students, gave faculty opportunities to
introduce their research to students and to
mentor students research. Future development
Integrate Bioinformatics workshop into students
curriculum. A course Bioinformatics
Biomolecular systems has been piloted. Through
cyber-infrastructure to disseminate
Bioinformatics workshop to BCC and other
community colleges. Involve more mentors for
Bioinformatics workshop projects and supervision
of Bioinformatics related research during the
academic year. The Pathways Center The STEP
Grant has initiated the development of a research
infrastructure dedicated to supporting
undergraduate research, which is co-sponsored by
HHMI education program, and directed by Dr.
Yuying Q. Gosser. Facilities include a
computational center, a presentation and
discussion room, a research laboratory for
protein expression and crystallization, and an
x-ray instrument donated by Novartis. This
Center will serve as an infrastructure to
coordinate, facilitate, and expand the STEP
program activities in CUNY coalition.
? Oneil Gorden Philipa Njau and Jeremy Taylor

High School Students

• Features
• Lectures were combined with hands-on computer
  exercises for major topics
• 2. Invited speakers covered broad basis of
  bioinformatics
• 3. Workshop leaders facilitated students
  completion of independent projects.
• 4. Students presented their projects at the
  workshop poster session.
• 5. Students attended New York structural biology
  group annual symposium
• with poster presentations in Cold Spring
  Harbor laboratory.
• 6. A special one day workshop on Structural
  genomics featured with model building
• of DNA base-pair and dipeptides, invited
  lecturer, panel discussion of research
• participation and filed trip visit New York
  Structural Biology Center.
• 7.Outreach to high school students pilot class,
  five HS students completed the 2005
• summer workshop and presented posters.

Dr. Yuying Gosser, the Director of the Pathways
Bioinformatics Center at CCNY, and a group of
students (from left Victor Barleycorn, Jamie-Lee
Foote, Adrian Nicholas, Chelsea Jin, Yuying
Gosser), presented the posters of the Summer
Bioinformatics Workshop at the Annual Symposium
of New York Structural Biology Group, on Aug. 10,
2005, at CSHL.
Representative posters
Peer-Leaders in Summer Bioinformatics Workshops

• Adrien Nicholas ?

Finding the melting point of DNA using Perl
Alejandro NievesThurgood Marshall Academy, Junior
At Bronx Community College, the NSF STEP and PMT
(Pharmaceutical Manufacturing Technology)
programs have reinvigorated the courses and the
programs of the Department of Chemistry.Since the
start of these programs the number of students
majoring in the Department degree programs has
grown from a handful in Fall 2002 to
approximately 100 students in Fall 2005. Of this
total 40 students are PMT majors (surpassing the
enrollment objective of the NSF PMT proposal),
and 40 students are chemistry majors. To date
more than 25 BCC students and four faculty have
participated in molecular modeling and
bioinformatics workshops and other training
activities. After these introductory activities
the students become workshop leaders for the PLTL
program in chemistry, mathematics and biology at
BCC and help in recruitment efforts for BCC
science programs. In the Chemistry Department
each semester approximately 46 students (two
sections) are enrolled in College General
Chemistry I (CHM 11) with weekly PLTL workshop
sessions led by 3 student workshop leaders.
Each semester more than 500 hundred high school
students participate in on campus enrichment,
orientation and instrument demonstration
activities. Another 200 high school students take
weekly College NOW classes offered in the
Chemistry Department laboratories and facilities.
Of these approximately 35 high school students
take a credit bearing course entitled Computer
Applications in Chemistry (CHM 38). This
specialized course was designed in part as a
preliminary course for students intending to take
the bioinformatics workshop.
Program Structure Input a given DNA
sequence Open (file, DNA.txt) Initialize
counter and count the A's,Ts,Gs and Cs
in the sequence Calculate melting point of DNA
sequence. If DNA sequence is larger than 14-20
base pairs use equation
Td 2(AT) 4(GC) If DNA sequence is
larger then 50 base pairs use equation Tm 81.5
16.6 log M 41(XGXC) - 500/L - 0.62F
Validation CCTTGGCGGCTACTGCTGGGA
AGTGCCATGAGCAGGCCCATCATACATTTCGGCAGTGA The
published melting point of this sequence is
program produced is 59C The melting point from
my program is 59.6C
Abstract In this poster I will be explaining
how, Using Perl, I was able to find the melting
point of DNA. The melting point being the
temperature where fifty percent of the double
helix that makes up DNA, is in a duplex form.
Meaning that the DNA has been denatured into
single strands. By using Perl I was able to
develop a script that would allow me to know the
melting point of any DNA. Even though there are
websites where you can submit a DNA sequence to
find the melting point. I made this program as an
exercise to make me more familiar with
bioinformatics data banking. Also, I wanted to
have a program like this on standby so that I
would not have to wait to receive an answer if I
did submit my DNA sequence.
The Pathways Project is supported by NSF-STEP
program and the Howard Hughes Medical Institute.