Title: Islands of perfect conservation within UCSC multiple
1Islands of perfect conservation within UCSC
multiple alignments within Ancient
Repeats Log2(Count) vs Size of island expect
log count (size) log p
2- 21 Islands of perfect 4-way (DHMR) conservation
gt70bp. - 7/21 are within elements called MER121
- MER medium reiterated frequency repeats
- MER121 909 elements in human, 891 in dog
- Not in rodent repeat libraries
- possible non-autonomous DNA transponson
- but is the ONLY repeat whose family is unknown
3Count how often UCSC PhastCons elements (1.6M)
overlap all ancient repeat types.
Rank by how often repeat type is touched (for
copy gt2)
repeat type repeat family
touched in genome touched
MER121 Unknown 74.81 909
680 tRNA-Ile-ATT tRNA
43.75 32 14 5S
rRNA 26.67 30 8
L3b LINE/CR1 25.61
7689 1969 MER90-int
LTR/ERV1 18.18 11 2
MARNA DNA/Mariner 16.09 3288
529 Kanga1c DNA/Tc2
15.64 179 28 LTR11
LTR/ERV 15.00 20 3
LTR6A LTR/ERV1 12.73
220 28 MER102a
DNA/MER1_type 12.35 324 40
L3 LINE/CR1 12.23
47395 5798 MER117
DNA/MER1_type 12.11 4408 534
Tigger8 DNA/MER2_type 11.60
845 98 MLT1K-int
LTR/MaLR 11.11 9 1
4Conditional on being touched, rank repeats by
median Conservation UCSC conservation score.
rank repeat type count median score
1 LTR6A 28 median919 2
MER34B-int 20 median150 3
L1MA4 16 median97 4
L1MA6 19 median67 5
Tigger3 10 median57 6
MER121 680 median56 7
SVA 41 median54 8 MADE1
18 median42 9 L1MA4A 14
median39 10 tRNA-Ile-ATT 14
median39 11 Tigger1 21
median34 12 Tigger7 11
median34 13 MER7A 10
median32 14 L1MA5 14
median30 15 L3b 1969
median27 16 L1M2 40
median26 17 Charlie6 10
median22
Median for ALL 1.6M phastCons elements 22
5Imporant check Conservation is syntenic. UCSC
vs our naïve multiple alignments (guaranteed to
be syntenic, 1-1)
Total Human MER121 909 Found UCSC
752 Found naive
852 Found by both
607 consistent placement
6RepeatMasker consensus for MER121 has 416 bases.
Does NOT seem to be flanked by inverted tandem
repeats BUT does contain an internal palindrome
CGTTTTGGGTTCGGCAAAACCCAAAACG word
CGTTTTGGGTTTTGCCGAACCCAAAACG
RC(word)
gtMER121Unknown 26-27 CCATCTAAATTAGGGATGGGCAAAC
CCGGCNGCATTTTGGGTTCGGCAAACATCTTGAACTATTTTTCAAA CGT
TTTGGGTTCGGCAAAACCCAAAACG CATTTTGCCAAGCACTTTTCCCCT
TAATTTTTAAACCCATGTGTATTTCAAGGGAAATTTAATCCATATGTTTC
TGATTCATTTACACTTAACTCATCAAAATGTTGTTTTGTAAGAGCTATT
TGATGTCCAAGAAGCCTTNTGAGC CTTTTTAATAAGCTTTTCAAGCCTT
TTTTTCTTAGAAACAGGAAGTCGTGTTTTGCCAAGAGTAAATGAAACT C
GAACCCCCAAAGGNTTGGGTTCGGTTTGAAACTCAGAACCCACGAGGTTN
AAGTGGNTCCTNAGCTTGG CCAANCGCNTTCCCCCACTCCTG
7Some elements are found in TarjeiXiaohuis
clusters 11 of the 84 clusters contain MER121
sites. 19 of the 607 sites are contained within
clusters Some clusters have more than one site-
most 4
8TarjeiXiaohuis clusters with MER121 elements
1 Cluster chr1935186461-36901737 has 4
site(s) "ZNF536, ZNF537, ZNF507 - Zinc finger
transcription factors, both expressed in brain
and other tissues 2 Cluster chr2143879946-1471
83119 has 3 site(s) "ZFHX1B - Zinc finger
homeobox, implicated in neurological disorders,
also potential novel brain expressed mRNA 3
Cluster chr187313944-88398677 has 2
site(s) LMO4 LIM domain transcription factor
(brain-half specific) 4 Cluster
chr3170316097-170779490 has 2
site(s) EVI1/MDS2 two transcription factors
involved in AML 5 Cluster chr591829695-93842638
has 2 site(s) "Unknown proteins, uncluding
potential transcription factors 6 Cluster
chr2174764990-176812772 has 1 site(s) HoxD
cluster and SP3 7 Cluster chr5158056203-15823411
1 has 1 site(s) EBF1 transcription factor 8
Cluster chr893037904-93692300 has 1
site(s) RUNX1T1 zinc finger transcription
regulator 9 Cluster chr1076691896-77501420 has
1 site(s) ZNF503 and Unknown C10ORF11 10
Cluster chr1534574942-35300886 has 1
site(s) MEIS2 Homeobox transcription factor 11
Cluster chr1828576553-29014798 has 1
site(s) "KLHL14 a large brain expressed gene and
C18ORF34, a hypotethical gene"