The following two questions make use of the same stem:

1 / 1
About This Presentation
Title:

The following two questions make use of the same stem:

Description:

A cryptic 5' donor. splice site is indicated by the slash within the intron. ... C. Splicing would occur at the cryptic splice site making the protein longer. ... –

Number of Views:38
Avg rating:3.0/5.0
Slides: 2
Provided by: kum77
Category:

less

Transcript and Presenter's Notes

Title: The following two questions make use of the same stem:


1
The following two questions make use of the same
stem
The following shows a sequence near the 5' end of
a pre-mRNA, with exons in uppercase and the
intron in lowercase. The codons are separated by
periods (you can assume that this is only a
portion of a much larger pre-mRNA containing
numerous exons and introns). A cryptic 5' donor
splice site is indicated by the slash within the
intron.
5'...AGC.UAC.CAGguuaguugacag/guagauuagaccauguaagc
cucuuccuuucagGAU.GUA.AUG...3'
What would be the consequence of a g to c
mutation at the 5' end of the intron?
A. Splicing would not be affected.
B. The intron would not be spliced making the
protein longer.
C. Splicing would occur at the cryptic splice
site making the protein longer.
D. Splicing would occur at the cryptic splice
site making the protein shorter.
E. None of the above is possible. (17)
What would be the consequence of a g deletion
at the 5' end of the intron?
A. Splicing would not be affected.
B. The intron would not be spliced making the
protein longer.
C. Splicing would occur at the cryptic splice
site making the protein longer.
D. Splicing would occur at the cryptic splice
site making the protein shorter.
E. None of the above is possible. (13)
Write a Comment
User Comments (0)
About PowerShow.com