MCDB 3500

1
MCDB 3500
Exam 4
Fall, 2002
50 minutes close everything be to the point!
Name
--------------------------------------------------
-------------
ID
--------------------------------------------------
-------------
Q1 (15 points)
--------------------------------
Q2 (15 points)
--------------------------------
Q3 (15 points)
--------------------------------
Q4 (15 points)
--------------------------------
Q5 (15 points)
--------------------------------
Q6 (15 points)
--------------------------------
Q7 (10 points take home)
--------------------------------
Total (100)
--------------------------------
Grade
----------
2
A
B
C
4
3
Question 1. You synthesized two radiolabeled
RNAs. One RNA shown in panel A was incubated with
or without GTP. The spliced products were
separated on a gel, and identified by
autoradiography. The second RNA, when incubated
with or without GTP under the same conditions as
in panel A, gave the pattern shown in panel B.
However, the second RNA, when incubated for
0-180 (minutes) with a cell extract,that is
capable of splicing in vitr,o gave the pattern
shown in panel C. M is size markers.

• Label the bands indicated by arrows, and explain
  why you labeled them that way a relevant
• schematic (with label) next to the arrows is
  preferred.

B) What 3 important conclusions can you draw ?
C) Which conclusion could not be drawn if panel B
is missing, why ?
3
Question 2A. You are given 4 test tubes with one
of the following RNAs. How will you find out
which RNA is present in a tube? You have access
to various reagents such as radioactivity, and
enzymes (kinase, phosphatase, pyrophosphatase,
polymerase, restriction enzyme, and more if you
like). Briefly explain, using flow diagram(s),
the steps leading to your conclusions for each.
i
ii
iii
iv
GpppA
pppA
--- OR ---
B) You intruduced the following RNA into
intestine, liver or kidney cells. Unexpectedly,
you found that the RNA translated into a 5 amino
acid polypeptide in interstine, 4 amino acid
polypeptide in liver, and 7 in kidney. For your
reference, AUG is a translation initiation codon
for methionine, and UAA, UGA, and UAG are
translation stop codons. Briefly explain what
molecular events could give rise to the
different sized polypeptides.
ACCAGGAUGCGAGGAAGACGAUGAGGUGAGGAGGC
AAAAAAAA
cap
4
Question 3A. The genes for the U1 snRNA, U1wt
(wild type) or U1?D (deleted of the Sm-binding
site), were cloned downstream of either a pol
II promoter, called pII U1, or downstream of a
pol III promoter, called pIII. These DNAs were
injected into Frog oocytes in the presence of a
radioactively labeled nucleotide? After 2 hr
incubation, you fractionated the nuclear (N),
cytoplasmic (C), and Total (T) fractions,
separated the RNA in a gel, and exposed to an
X-ray film. (Ignore the faint band, 5.8S, at the
very top (lane 1 and 3). Sm-binding site is a
short nucleotide sequence in the RNA to which Sm
proteins bind.
A) What 2 important conclusion(s) can you draw
from this experiment, and why?
Question 3B. Give an example of negative
regulation of splicing, explain with a schematic?
5
Question 4. Define/explain the following.
1. Combinatorial control
2. Debranching
3. Lariat
4. Trans splicing
5. Ribozyme
6. Double stranded RNA interference (dsRNAi)
7. Alternative splicing
8. Yeast two-hybrid
9. RNA Editing
10. 3 splice site switching
6
Question 5A. Label what 5 arrows point to in this
figure. Explain why you chose them ?.
Question 5B. Describe 2 similarities and 2
differences in the splicing mechanisms of Group
I, Group II, and nuclear pre-mRNA splicing.
Group I
Group II
nuclear pre-mRNA
Similarities
Differences
7
A
B
C

• Question 6. Three different, radiolabeled RNAs
  were transcribed with different cap structures,
  shown in the
• top panel.
• The splicing substrates were incubated with an
  extract for splicing in vitro. Following
  incubation for
• various times (min), the spliced RNAs and the
  intermediates were separated on a gel and exposed
  to an X-ray
• film. Various splicing products are indicated.
• What 2 conclusions can you draw from this
  experiment ?
• Which conclusion cannot be drawn if panel C is
  missing, and why ?