Pkdd PowerPoint PPT Presentations

All Time
Show:
Recommended
Sort by:
PKDD Discovery Challenge (not only) on Financial Data PowerPoint PPT Presentation
PKDD Discovery Challenge (not only) on Financial Data - PKDD Discovery Challenge (not only) on ... short time for analysis (2-3 months) ... Workshop at PKDD to present the results and discus them with domain experts ...
PKDD Discovery Challenge (not only) on ... short time for analysis (2-3 months) ... Workshop at PKDD to present the results and discus them with domain experts ...
| PowerPoint PPT presentation | free to view
Retour dexprience Challenge PKDD 20012003 PowerPoint PPT Presentation
Retour dexprience Challenge PKDD 20012003 - 2 bases issues d'un h pital, d'un centre de consultation et 1 banque d'examens biologiques. Objectifs ... 2 bases issues d'une tude de cohorte, l'une mesurant divers ...
2 bases issues d'un h pital, d'un centre de consultation et 1 banque d'examens biologiques. Objectifs ... 2 bases issues d'une tude de cohorte, l'une mesurant divers ...
| PowerPoint PPT presentation | free to view
- Relational - Graphical Models PowerPoint PPT Presentation
- Relational - Graphical Models - Advanced I WS 06/07 Based on Cussens and Kersting s ICML 2004 tutorial, De Raedt and Kersting s ECML/PKDD 2005 tutorial, and Friedman and Koller s
Advanced I WS 06/07 Based on Cussens and Kersting s ICML 2004 tutorial, De Raedt and Kersting s ECML/PKDD 2005 tutorial, and Friedman and Koller s
| PowerPoint PPT presentation | free to download
Ontology Learning PowerPoint PPT Presentation
Ontology Learning - Tutorial at ECML/PKDD, Oct. 2005, Porto, Portugal. ... Co-occurrence (collocation) analysis for term extraction within the corpus ...
Tutorial at ECML/PKDD, Oct. 2005, Porto, Portugal. ... Co-occurrence (collocation) analysis for term extraction within the corpus ...
| PowerPoint PPT presentation | free to view
European Project Presentation Day PowerPoint PPT Presentation
European Project Presentation Day - European Project Presentation Day. PKDD Helsinki, 20.08.2002. KDNet. European Knowledge Discovery ... A roadmap on knowledge discovery research and technology ...
European Project Presentation Day. PKDD Helsinki, 20.08.2002. KDNet. European Knowledge Discovery ... A roadmap on knowledge discovery research and technology ...
| PowerPoint PPT presentation | free to view
Discovering Interesting Regions in Spatial Data Sets using Supervised Clustering PowerPoint PPT Presentation
Discovering Interesting Regions in Spatial Data Sets using Supervised Clustering - PKDD Conference, Berlin, Sept. 21, 2006. Department of Computer Science ... for the Volcano dataset for b=1.01, =6, which can be attributed to the fact that ...
PKDD Conference, Berlin, Sept. 21, 2006. Department of Computer Science ... for the Volcano dataset for b=1.01, =6, which can be attributed to the fact that ...
| PowerPoint PPT presentation | free to download
European Project Presentation Day PowerPoint PPT Presentation
European Project Presentation Day - KDNet at a Glance KDNet is the European Knowledge Discovery Network of Excellence the largest European Network for Data Mining and ... KD from Spatial ...
KDNet at a Glance KDNet is the European Knowledge Discovery Network of Excellence the largest European Network for Data Mining and ... KD from Spatial ...
| PowerPoint PPT presentation | free to download
Markov Logic: A Representation Language for Natural Language Semantics PowerPoint PPT Presentation
Markov Logic: A Representation Language for Natural Language Semantics - E.g.: Anna, X, mother_of(X), friends(X, Y) Grounding: Replace all variables by constants ... Suppose we have two constants: Anna (A) and Bob (B) More on MLNs ...
E.g.: Anna, X, mother_of(X), friends(X, Y) Grounding: Replace all variables by constants ... Suppose we have two constants: Anna (A) and Bob (B) More on MLNs ...
| PowerPoint PPT presentation | free to download
UBICOMP PowerPoint PPT Presentation
UBICOMP - UBICOMP 01. A Hybrid Evaluation Approach for Ubiquitous Computing Environments ... suggests hybrid of qualitative and quantitative approaches ...
UBICOMP 01. A Hybrid Evaluation Approach for Ubiquitous Computing Environments ... suggests hybrid of qualitative and quantitative approaches ...
| PowerPoint PPT presentation | free to view
University of Economics, Prague PowerPoint PPT Presentation
University of Economics, Prague - KEX (decision rules), large preprocessing module including SQL, ... Berka,P. - Rauch,J.: Data Mining using GUHA and KEX. In: (Callaos, Yang, Aguilar eds. ...
KEX (decision rules), large preprocessing module including SQL, ... Berka,P. - Rauch,J.: Data Mining using GUHA and KEX. In: (Callaos, Yang, Aguilar eds. ...
| PowerPoint PPT presentation | free to download
A Brief History of Data Mining Society PowerPoint PPT Presentation
A Brief History of Data Mining Society - ... ICDE WWW, SIGIR ICML, CVPR, NIPS Journals Data Mining and Knowledge Discovery (DAMI or DMKD) IEEE Trans. On Knowledge and Data Eng. (TKDE) ...
... ICDE WWW, SIGIR ICML, CVPR, NIPS Journals Data Mining and Knowledge Discovery (DAMI or DMKD) IEEE Trans. On Knowledge and Data Eng. (TKDE) ...
| PowerPoint PPT presentation | free to download
Fast Algorithms for Querying and Mining Large Graphs PowerPoint PPT Presentation
Fast Algorithms for Querying and Mining Large Graphs - www.cs.cmu.edu
www.cs.cmu.edu
| PowerPoint PPT presentation | free to download
??, ??????????????????, ???????(Knowledge Discovery in Databases KDD)???????? PowerPoint PPT Presentation
??, ??????????????????, ???????(Knowledge Discovery in Databases KDD)???????? - Title: PowerPoint Presentation Last modified by: Created Date: 1/1/1601 12:00:00 AM Document presentation format: Other titles
Title: PowerPoint Presentation Last modified by: Created Date: 1/1/1601 12:00:00 AM Document presentation format: Other titles
| PowerPoint PPT presentation | free to view
Additive noise perturbation model PowerPoint PPT Presentation
Additive noise perturbation model - On the Lower Bound of Reconstruction Error for Spectral Filtering Based PPDM Songtao Guo, Xintao Wu, Yingjiu Li Motivation Additive noise perturbation model
On the Lower Bound of Reconstruction Error for Spectral Filtering Based PPDM Songtao Guo, Xintao Wu, Yingjiu Li Motivation Additive noise perturbation model
| PowerPoint PPT presentation | free to view
Lei Shi PowerPoint PPT Presentation
Lei Shi - Title: PowerPoint Presentation Last modified by: Lei Shi Created Date: 1/1/1601 12:00:00 AM Document presentation format: On-screen Show Other titles
Title: PowerPoint Presentation Last modified by: Lei Shi Created Date: 1/1/1601 12:00:00 AM Document presentation format: On-screen Show Other titles
| PowerPoint PPT presentation | free to download
?? PowerPoint PPT Presentation
?? - Title: Author: Last modified by: Hiroki Arimura Created Date: 7/7/1998 2:12:06 PM Document presentation format
Title: Author: Last modified by: Hiroki Arimura Created Date: 7/7/1998 2:12:06 PM Document presentation format
| PowerPoint PPT presentation | free to download
Graph Mining Applications in Machine Learning Problems PowerPoint PPT Presentation
Graph Mining Applications in Machine Learning Problems - Graph Mining Applications in Machine Learning Problems Max Planck Institute for Biological Cybernetics Koji Tsuda
Graph Mining Applications in Machine Learning Problems Max Planck Institute for Biological Cybernetics Koji Tsuda
| PowerPoint PPT presentation | free to download
A new medical test for for atherosclerosis detection GeNo PowerPoint PPT Presentation
A new medical test for for atherosclerosis detection GeNo - 2/ Only sufficient (not necessary) conditions can be extracted from data bases. Ex. ... graphical analysis of one risk factor for the healthy and ill patient ...
2/ Only sufficient (not necessary) conditions can be extracted from data bases. Ex. ... graphical analysis of one risk factor for the healthy and ill patient ...
| PowerPoint PPT presentation | free to view
Introduction --- Part2 PowerPoint PPT Presentation
Introduction --- Part2 - Introduction --- Part2 Another Introduction to Data Mining Course Information * * * * * * * * Knowledge Discovery in Data [and Data Mining] (KDD) Let us find ...
Introduction --- Part2 Another Introduction to Data Mining Course Information * * * * * * * * Knowledge Discovery in Data [and Data Mining] (KDD) Let us find ...
| PowerPoint PPT presentation | free to download
Data Mining Association Rules PowerPoint PPT Presentation
Data Mining Association Rules - Different M value affect the performance of DIC algorithm, Apriori algorithms put here is as an reference. We can see as the M increase, ...
Different M value affect the performance of DIC algorithm, Apriori algorithms put here is as an reference. We can see as the M increase, ...
| PowerPoint PPT presentation | free to download
Related work of Search Result Clustering PowerPoint PPT Presentation
Related work of Search Result Clustering - A personalized search engine based on web-snippet hierarchical clustering. WWW '05, ... Anatomy of SnakeT: A Hierarchical Clustering Engine for Web-Page Snippets ...
A personalized search engine based on web-snippet hierarchical clustering. WWW '05, ... Anatomy of SnakeT: A Hierarchical Clustering Engine for Web-Page Snippets ...
| PowerPoint PPT presentation | free to view
Knowledge Transfer via Multiple Model Local Structure Mapping PowerPoint PPT Presentation
Knowledge Transfer via Multiple Model Local Structure Mapping - Reuters. Newsgroup. 7 /17. A Synthetic Example. Training (have conflicting ... with different sub-fields in the training and test sets (Newsgroup, Reuters) ...
Reuters. Newsgroup. 7 /17. A Synthetic Example. Training (have conflicting ... with different sub-fields in the training and test sets (Newsgroup, Reuters) ...
| PowerPoint PPT presentation | free to view
Graph Mining: patterns and tools for static and time-evolving graphs PowerPoint PPT Presentation
Graph Mining: patterns and tools for static and time-evolving graphs - Graph Mining: patterns and tools for static and time-evolving graphs
Graph Mining: patterns and tools for static and time-evolving graphs
| PowerPoint PPT presentation | free to download
Knowledge Transfer via Multiple Model Local Structure Mapping PowerPoint PPT Presentation
Knowledge Transfer via Multiple Model Local Structure Mapping - Knowledge Transfer via Multiple Model Local Structure Mapping. Jing Gao Wei Fan Jing Jiang Jiawei Han. University of Illinois at Urbana-Champaign ...
Knowledge Transfer via Multiple Model Local Structure Mapping. Jing Gao Wei Fan Jing Jiang Jiawei Han. University of Illinois at Urbana-Champaign ...
| PowerPoint PPT presentation | free to view
A three-step approach for STULONG database analysis: characterization of patients PowerPoint PPT Presentation
A three-step approach for STULONG database analysis: characterization of patients - Smoker. If smokerconsumption!=0 OR duration then 1 else 0. 13 ... AGE & SMOKER & CHOL is less frequent in group12 than in group5. etc ...
Smoker. If smokerconsumption!=0 OR duration then 1 else 0. 13 ... AGE & SMOKER & CHOL is less frequent in group12 than in group5. etc ...
| PowerPoint PPT presentation | free to view
Analysing Clickstream Data: From Anomaly Detection to Visitor Profiling PowerPoint PPT Presentation
Analysing Clickstream Data: From Anomaly Detection to Visitor Profiling - A chronologically ordered sequence of 'clicks' from the same IP-address to the same shop ... Profile 2 Focused search. Profile 3 Potential buyers. Profile 4 ...
A chronologically ordered sequence of 'clicks' from the same IP-address to the same shop ... Profile 2 Focused search. Profile 3 Potential buyers. Profile 4 ...
| PowerPoint PPT presentation | free to view
Mining static and time-evolving graphs PowerPoint PPT Presentation
Mining static and time-evolving graphs - LLNL, Feb. '07. C. Faloutsos. 1. School of Computer Science. Carnegie Mellon ... LLNL, Feb. '07. C. Faloutsos. 5. School of Computer Science. Carnegie Mellon ...
LLNL, Feb. '07. C. Faloutsos. 1. School of Computer Science. Carnegie Mellon ... LLNL, Feb. '07. C. Faloutsos. 5. School of Computer Science. Carnegie Mellon ...
| PowerPoint PPT presentation | free to download
Max-Margin Weight Learning for Markov Logic Networks PowerPoint PPT Presentation
Max-Margin Weight Learning for Markov Logic Networks - Title: Discriminative Structure and Parameter Learning for Markov Logic Networks Author: Tuyen Ngoc Huynh Last modified by: Tuyen Ngoc Huynh Created Date
Title: Discriminative Structure and Parameter Learning for Markov Logic Networks Author: Tuyen Ngoc Huynh Last modified by: Tuyen Ngoc Huynh Created Date
| PowerPoint PPT presentation | free to download
Data%20Stream%20Management%20Systems%20Checkpoint PowerPoint PPT Presentation
Data%20Stream%20Management%20Systems%20Checkpoint - Bagging ... Bagging Ensemble Method. 13. 13. Mining Streams with Concept Changes ... of boosting ensembles is better than that of bagging ensembles [KDD04] ...
Bagging ... Bagging Ensemble Method. 13. 13. Mining Streams with Concept Changes ... of boosting ensembles is better than that of bagging ensembles [KDD04] ...
| PowerPoint PPT presentation | free to download
Efficient Frequent Query Discovery in FARMER PowerPoint PPT Presentation
Efficient Frequent Query Discovery in FARMER - Title: No Slide Title Author: snijssen Last modified by: W.K.S Walker Created Date: 9/8/2003 9:33:38 PM Document presentation format: On-screen Show
Title: No Slide Title Author: snijssen Last modified by: W.K.S Walker Created Date: 9/8/2003 9:33:38 PM Document presentation format: On-screen Show
| PowerPoint PPT presentation | free to download
Identifying%20Bug%20Signatures%20Using%20Discriminative%20Graph%20Mining PowerPoint PPT Presentation
Identifying%20Bug%20Signatures%20Using%20Discriminative%20Graph%20Mining - ISSTA 09 Identifying Bug Signatures Using Discriminative Graph Mining Hong Cheng1, David Lo2, Yang Zhou1, Xiaoyin Wang3, and Xifeng Yan4 1Chinese University of Hong ...
ISSTA 09 Identifying Bug Signatures Using Discriminative Graph Mining Hong Cheng1, David Lo2, Yang Zhou1, Xiaoyin Wang3, and Xifeng Yan4 1Chinese University of Hong ...
| PowerPoint PPT presentation | free to download
Modeling Real Graphs using Kronecker Multiplication PowerPoint PPT Presentation
Modeling Real Graphs using Kronecker Multiplication - Modeling Real Graphs using Kronecker Multiplication. Jure Leskovec, Christos Faloutsos ... Scree plot. log rank. log eigenvalue. log rank. Scalability ...
Modeling Real Graphs using Kronecker Multiplication. Jure Leskovec, Christos Faloutsos ... Scree plot. log rank. log eigenvalue. log rank. Scalability ...
| PowerPoint PPT presentation | free to view
Density-Based Clustering Algorithms PowerPoint PPT Presentation
Density-Based Clustering Algorithms - Density-based: based on connectivity and density functions ... Density and connectivity are measured by local distribution of nearest neighbor ...
Density-based: based on connectivity and density functions ... Density and connectivity are measured by local distribution of nearest neighbor ...
| PowerPoint PPT presentation | free to view
Course on Data Mining (581550-4) PowerPoint PPT Presentation
Course on Data Mining (581550-4) - Title: No Slide Title Author: Dept. of Computer Science Last modified by: Mika Klemettinen Created Date: 6/17/1995 11:31:02 PM Document presentation format
Title: No Slide Title Author: Dept. of Computer Science Last modified by: Mika Klemettinen Created Date: 6/17/1995 11:31:02 PM Document presentation format
| PowerPoint PPT presentation | free to download
Prof' Dr' Bettina Berendt PowerPoint PPT Presentation
Prof' Dr' Bettina Berendt - 1. Web Usage Mining. Evaluation. Prof. Dr. Bettina Berendt. Humboldt Univ. Berlin, Germany ... Tutorial at the 15th European Conference on Machine Learning ...
1. Web Usage Mining. Evaluation. Prof. Dr. Bettina Berendt. Humboldt Univ. Berlin, Germany ... Tutorial at the 15th European Conference on Machine Learning ...
| PowerPoint PPT presentation | free to view
Graph%20Mining%20and%20Influence%20Propagation PowerPoint PPT Presentation
Graph%20Mining%20and%20Influence%20Propagation - Create N1 N1 probability matrix P1. Compute the kth Kronecker power Pk. For each entry puv of Pk include an edge (u,v) with probability puv. 0.3. 0.1. 0.2. 0.4 ...
Create N1 N1 probability matrix P1. Compute the kth Kronecker power Pk. For each entry puv of Pk include an edge (u,v) with probability puv. 0.3. 0.1. 0.2. 0.4 ...
| PowerPoint PPT presentation | free to download
Biomine search engine for probabilistic graphs PowerPoint PPT Presentation
Biomine search engine for probabilistic graphs - A graphical representation of biological data. Nodes: genes, proteins, tissues, processes, ... (Gene interactions and gene-phonotype relations were also removed) ...
A graphical representation of biological data. Nodes: genes, proteins, tissues, processes, ... (Gene interactions and gene-phonotype relations were also removed) ...
| PowerPoint PPT presentation | free to view
Exploiting Tag-Based Personalization for Recommendation on Social Web Frederico Dur PowerPoint PPT Presentation
Exploiting Tag-Based Personalization for Recommendation on Social Web Frederico Dur - ... recommender systems and search engine Research Overview Intuition, ... Semantic Similarity Model ... Web search personalization with ontological user profiles.
... recommender systems and search engine Research Overview Intuition, ... Semantic Similarity Model ... Web search personalization with ontological user profiles.
| PowerPoint PPT presentation | free to download
A New Scheme on Privacy Preserving Association Rule Mining PowerPoint PPT Presentation
A New Scheme on Privacy Preserving Association Rule Mining - ... Users' Attitudes about Online Privacy', AT&T Labs-Research, Technical Report TR 99.4.3, 1999 ... Thank you. Questions. email: nzhang@cs.tamu.edu ...
... Users' Attitudes about Online Privacy', AT&T Labs-Research, Technical Report TR 99.4.3, 1999 ... Thank you. Questions. email: nzhang@cs.tamu.edu ...
| PowerPoint PPT presentation | free to view
Griffith University PowerPoint PPT Presentation
Griffith University - Prof. Peter Eklund Prof. Rudolf Wille (Darmstadt) Dr. John Thorton Dr. Peter Deer (DSTO) ... Deer and Eklund. RESEARCH PUBLICATIONS. plus 12 refereed ...
Prof. Peter Eklund Prof. Rudolf Wille (Darmstadt) Dr. John Thorton Dr. Peter Deer (DSTO) ... Deer and Eklund. RESEARCH PUBLICATIONS. plus 12 refereed ...
| PowerPoint PPT presentation | free to view
Graph Mining: Laws, Generators and Tools PowerPoint PPT Presentation
Graph Mining: Laws, Generators and Tools - Other projects (Virus propagation, e-bay fraud detection) Conclusions ... Problem#2: How do they evolve? Problem#3: How to generate realistic graphs. TOOLS ...
Other projects (Virus propagation, e-bay fraud detection) Conclusions ... Problem#2: How do they evolve? Problem#3: How to generate realistic graphs. TOOLS ...
| PowerPoint PPT presentation | free to download
Web Mining PowerPoint PPT Presentation
Web Mining - ... logs, registration information, demographics, past history, etc. ... EX: Head Hunting, SIG Hunting, Weather Report KB. Ontology. EX: Concept Hierarchy, Relations ...
... logs, registration information, demographics, past history, etc. ... EX: Head Hunting, SIG Hunting, Weather Report KB. Ontology. EX: Concept Hierarchy, Relations ...
| PowerPoint PPT presentation | free to view
Biological Text Mining PowerPoint PPT Presentation
Biological Text Mining - Principles and Practice of Knowledge Discovery in Databases ... also stative verbs such as know, like, ... Nominalizations. My hand washing was a nightmare ...
Principles and Practice of Knowledge Discovery in Databases ... also stative verbs such as know, like, ... Nominalizations. My hand washing was a nightmare ...
| PowerPoint PPT presentation | free to download
CS 685 Special Topics in Data mining PowerPoint PPT Presentation
CS 685 Special Topics in Data mining - Research paper(s) List of recommendations (will be available) Your own pick (upon approval) ... Order of presentation: will be arranged according to the topics ...
Research paper(s) List of recommendations (will be available) Your own pick (upon approval) ... Order of presentation: will be arranged according to the topics ...
| PowerPoint PPT presentation | free to download
DETECTION OF BURSTY AND EMERGING TRENDS TOWARDS IDENTIFICATON OF INFLUENTIAL RESEARCHERS AT THE EARLY STAGE OF TRENDS PowerPoint PPT Presentation
DETECTION OF BURSTY AND EMERGING TRENDS TOWARDS IDENTIFICATON OF INFLUENTIAL RESEARCHERS AT THE EARLY STAGE OF TRENDS - DETECTION OF BURSTY AND EMERGING TRENDS TOWARDS IDENTIFICATON OF INFLUENTIAL RESEARCHERS AT THE EARLY STAGE OF TRENDS Sheron Decker Computer Science Department
DETECTION OF BURSTY AND EMERGING TRENDS TOWARDS IDENTIFICATON OF INFLUENTIAL RESEARCHERS AT THE EARLY STAGE OF TRENDS Sheron Decker Computer Science Department
| PowerPoint PPT presentation | free to download
Graph Mining Applications in Machine Learning Problems PowerPoint PPT Presentation
Graph Mining Applications in Machine Learning Problems - 1. Graph Mining Applications. in Machine Learning Problems. Max Planck Institute for Biological Cybernetics. Koji Tsuda. 2. Existing methods assume ' tables' ...
1. Graph Mining Applications. in Machine Learning Problems. Max Planck Institute for Biological Cybernetics. Koji Tsuda. 2. Existing methods assume ' tables' ...
| PowerPoint PPT presentation | free to view
Text-Mining: analysis of text data PowerPoint PPT Presentation
Text-Mining: analysis of text data - ... Beatles Anthology: The Beatles, Paul McCartney, George Harrison, Ringo Starr, ... You're The One: Paul Simon. Kid A: Radiohead. Music: Madonna. Red Dirt ...
... Beatles Anthology: The Beatles, Paul McCartney, George Harrison, Ringo Starr, ... You're The One: Paul Simon. Kid A: Radiohead. Music: Madonna. Red Dirt ...
| PowerPoint PPT presentation | free to download
Finding Fuzzy Approximate Dependencies within STULONG Data PowerPoint PPT Presentation
Finding Fuzzy Approximate Dependencies within STULONG Data - 1. Finding Fuzzy Approximate Dependencies within STULONG Data ... VINO. 0.13/0.61. 0.10/0.62. 0.47/0.39. 0.10/0.62. PIVO12. 0.21/0.41. 0.16/0.43. 0.58/0.21 ...
1. Finding Fuzzy Approximate Dependencies within STULONG Data ... VINO. 0.13/0.61. 0.10/0.62. 0.47/0.39. 0.10/0.62. PIVO12. 0.21/0.41. 0.16/0.43. 0.58/0.21 ...
| PowerPoint PPT presentation | free to view
Trend Analysis and Risk Identification PowerPoint PPT Presentation
Trend Analysis and Risk Identification - Lenka Nov kov 1, Jir Kl ma1, Michal Jakob1, Simon Rawles2, Olga tep nkov 1 ... positive angina pectoris (silent) myocardial infarction. cerebrovascular accident ...
Lenka Nov kov 1, Jir Kl ma1, Michal Jakob1, Simon Rawles2, Olga tep nkov 1 ... positive angina pectoris (silent) myocardial infarction. cerebrovascular accident ...
| PowerPoint PPT presentation | free to view
Action Rules Discovery /Lecture I/ PowerPoint PPT Presentation
Action Rules Discovery /Lecture I/ - Action Rules Discovery /Lecture I/ by Zbigniew W. Ras UNC-Charlotte, USA
Action Rules Discovery /Lecture I/ by Zbigniew W. Ras UNC-Charlotte, USA
| PowerPoint PPT presentation | free to view
Additive noise perturbation model PowerPoint PPT Presentation
Additive noise perturbation model - September 18th-22nd, 2006 Berlin, Germany. Estimate individual values of U from the perturbed data --- H.Kargupta et al. ICDM 2003. Apply EVD on the covariance ...
September 18th-22nd, 2006 Berlin, Germany. Estimate individual values of U from the perturbed data --- H.Kargupta et al. ICDM 2003. Apply EVD on the covariance ...
| PowerPoint PPT presentation | free to download
Automatically Generating Gene Pathways from Biomedical Literature PowerPoint PPT Presentation
Automatically Generating Gene Pathways from Biomedical Literature - Molecular Bioengineering. of Biomass Conversion. Genomic Ecology of Global Change ... Ordering Graphs into Pathways using Biology Datasets ...
Molecular Bioengineering. of Biomass Conversion. Genomic Ecology of Global Change ... Ordering Graphs into Pathways using Biology Datasets ...
| PowerPoint PPT presentation | free to view
Efficient Text and Semi-structured Data Mining: Towards Knowledge Discovery in the Cyberspace PowerPoint PPT Presentation
Efficient Text and Semi-structured Data Mining: Towards Knowledge Discovery in the Cyberspace - CACA. TGTTTCTGT. AGGAGGT. Web pages, XML/SGML archives. Genome databases. E-mails, text files ... CACA. AGGAT. CCAA. CACA. AGGAT. CCAA. GTGTCACAAATTCTGTAGTATCA ...
CACA. TGTTTCTGT. AGGAGGT. Web pages, XML/SGML archives. Genome databases. E-mails, text files ... CACA. AGGAT. CCAA. CACA. AGGAT. CCAA. GTGTCACAAATTCTGTAGTATCA ...
| PowerPoint PPT presentation | free to view
Active Sampling for Knowledge Discovery from Biomedical Data PowerPoint PPT Presentation
Active Sampling for Knowledge Discovery from Biomedical Data - clinical features (e.g. status of the patient, relapse) ... TMA block is a paraffin block with 100-1000 tissue cores in array fasion ...
clinical features (e.g. status of the patient, relapse) ... TMA block is a paraffin block with 100-1000 tissue cores in array fasion ...
| PowerPoint PPT presentation | free to view
Contributions to MiningMart PowerPoint PPT Presentation
Contributions to MiningMart - KEX (decision rules) experimental software for building graphical models ... related to KEX. based on information theoretic approach ...
KEX (decision rules) experimental software for building graphical models ... related to KEX. based on information theoretic approach ...
| PowerPoint PPT presentation | free to download
TRACTS Trajectory Classification using Time Series PowerPoint PPT Presentation
TRACTS Trajectory Classification using Time Series - TRACTSTrajectory Classification using Time Series. Aluno: Irineu Junior Pinheiro dos Santos. Orientador:Luis Ot vio de Campos lvares
TRACTSTrajectory Classification using Time Series. Aluno: Irineu Junior Pinheiro dos Santos. Orientador:Luis Ot vio de Campos lvares
| PowerPoint PPT presentation | free to download


Home About Us Terms and Conditions Privacy Policy Contact Us
Copyright 2025 CrystalGraphics, Inc. — All rights Reserved. PowerShow.com is a trademark of CrystalGraphics, Inc.
pkdd — Search results on PowerShow.com