63 Graur PPTs View free & download

Dan Graur - Methods of Tree Reconstruction Dan Graur *

Methods of Tree Reconstruction Dan Graur *

| PowerPoint PPT presentation | free to download

Dan Graur - Rates of Nucleotide Substitution Dan Graur * * * * * * * * * * * * * * * * * * * In a comparison of 74 non-essential genes with 64 essential ones, the rate of ...

Rates of Nucleotide Substitution Dan Graur * * * * * * * * * * * * * * * * * * * In a comparison of 74 non-essential genes with 64 essential ones, the rate of ...

| PowerPoint PPT presentation | free to download

Dan Graur - Molecular Phylogenetics Dan Graur * * Maximize the probability of observing the data of aligned sequences conditional on a particular tree structure by trying all ...

Molecular Phylogenetics Dan Graur * * Maximize the probability of observing the data of aligned sequences conditional on a particular tree structure by trying all ...

| PowerPoint PPT presentation | free to download

Dan Graur - In molecular phylogenetics: A clade is a group of taxa under study that share a common ancestor, which is not shared by any other species outside the group.

In molecular phylogenetics: A clade is a group of taxa under study that share a common ancestor, which is not shared by any other species outside the group.

| PowerPoint PPT presentation | free to download

Dan Graur - In the distance matrix methods, evolutionary distances (usually the number of ... Once a derived character is lost, it cannot be regained. ...

In the distance matrix methods, evolutionary distances (usually the number of ... Once a derived character is lost, it cannot be regained. ...

| PowerPoint PPT presentation | free to view

Dan Graur - ... are identified in order of decreased similarity, and the tree is built in a ... composite OTU. 17. 18. 19. UPGMA works fine with ultrametric distances! ...

... are identified in order of decreased similarity, and the tree is built in a ... composite OTU. 17. 18. 19. UPGMA works fine with ultrametric distances! ...

| PowerPoint PPT presentation | free to view

Dan Graur - creation of a novel function from a redundant copy of an old ... Caudal vertebrae. 49. Vermiform appendix. Hind legs in cetaceans. 51. Dorudon atrox. 52 ...

creation of a novel function from a redundant copy of an old ... Caudal vertebrae. 49. Vermiform appendix. Hind legs in cetaceans. 51. Dorudon atrox. 52 ...

| PowerPoint PPT presentation | free to view

Dan Graur - Components of the Evolutionary Process in the Popular Press. 1. Gradualism. 2. Progress ... 18. Lamarckian. Devolution. 19. Evolution = Progress Gradualism ...

Components of the Evolutionary Process in the Popular Press. 1. Gradualism. 2. Progress ... 18. Lamarckian. Devolution. 19. Evolution = Progress Gradualism ...

| PowerPoint PPT presentation | free to view

Dan Graur - Panthera (lion, jaguar, leopard, tiger) Panthera leo (lion) The Linnaean hierarchy of Panthera leo (1/2): 32. Eukarya (nucleated cells) ...

Panthera (lion, jaguar, leopard, tiger) Panthera leo (lion) The Linnaean hierarchy of Panthera leo (1/2): 32. Eukarya (nucleated cells) ...

| PowerPoint PPT presentation | free to view

Dan Graur - ancestor ... ancestor. descendant 1. descendant 2. Anagenesis = changes occurring along an ... A taxon whose common ancestor is shared by any other ...

ancestor ... ancestor. descendant 1. descendant 2. Anagenesis = changes occurring along an ... A taxon whose common ancestor is shared by any other ...

| PowerPoint PPT presentation | free to view

Business Growth PowerPoint PPT Presentation

Business Growth - Image credit to graur razvan ionut / FreeDigitalPhotos.net

Image credit to graur razvan ionut / FreeDigitalPhotos.net

| PowerPoint PPT presentation | free to download

Bioinformatics PowerPoint PPT Presentation

Bioinformatics - Bioinformatics for Biologists * * Administrative stuff: Dr. Dan Graur dgraur@uh.edu Official TA: Nicholas Price Unofficial TAs: Yichen Zheng & Wenfu Li Science ...

Bioinformatics for Biologists * * Administrative stuff: Dr. Dan Graur dgraur@uh.edu Official TA: Nicholas Price Unofficial TAs: Yichen Zheng & Wenfu Li Science ...

| PowerPoint PPT presentation | free to download

Gene Substitution PowerPoint PPT Presentation

Gene Substitution - Gene Substitution Dan Graur * * A selective sweep takes approximately generations. In addition, the signature of positive ...

Gene Substitution Dan Graur * * A selective sweep takes approximately generations. In addition, the signature of positive ...

| PowerPoint PPT presentation | free to download

Evolution of Selfishness PowerPoint PPT Presentation

Evolution of Selfishness - Graur & Li. Fundamentals of Molecular Evolution (1999) ... 'When a given DNA, or class of DNAs, of unproven phenotypic function can be shown ...

Graur & Li. Fundamentals of Molecular Evolution (1999) ... 'When a given DNA, or class of DNAs, of unproven phenotypic function can be shown ...

| PowerPoint PPT presentation | free to view

Final Project PowerPoint PPT Presentation

Final Project - Final Project Bioinformatics for Biologists ... By using one ingroup sequence, identify one or more outgroup species.

Final Project Bioinformatics for Biologists ... By using one ingroup sequence, identify one or more outgroup species.

| PowerPoint PPT presentation | free to download

Mutation: Origin of genetic variation PowerPoint PPT Presentation

Mutation: Origin of genetic variation - Mutation: Origin of genetic variation sources of new alleles rate and nature of mutations sources of new genes highly repeated functional sequences

Mutation: Origin of genetic variation sources of new alleles rate and nature of mutations sources of new genes highly repeated functional sequences

| PowerPoint PPT presentation | free to download

mutation rates vary considerably among species PowerPoint PPT Presentation

mutation rates vary considerably among species - mutation rates vary considerably among species. mutation rates ... some genes occur as highly repeated tandem arrays. What produces homogeneous tandem arrays ? ...

mutation rates vary considerably among species. mutation rates ... some genes occur as highly repeated tandem arrays. What produces homogeneous tandem arrays ? ...

| PowerPoint PPT presentation | free to view

Mutation: Origin of genetic variation - synonymous substitutions -- no change in amino. acid identity ... plumage variation in the snow goose, Chen caerulescens. white phase. blue phase ...

synonymous substitutions -- no change in amino. acid identity ... plumage variation in the snow goose, Chen caerulescens. white phase. blue phase ...

| PowerPoint PPT presentation | free to download

What, if anything, are whales PowerPoint PPT Presentation

What, if anything, are whales - Sperm whale. Phocoena phocoena. Harbor porpoise. Orcinus orca. Killer whale. Toothed whales. Mysticeti. Odontoceti = Cetacea. Tragulus napu ...

Sperm whale. Phocoena phocoena. Harbor porpoise. Orcinus orca. Killer whale. Toothed whales. Mysticeti. Odontoceti = Cetacea. Tragulus napu ...

| PowerPoint PPT presentation | free to view

new alleles arise from changes in DNA sequence PowerPoint PPT Presentation

new alleles arise from changes in DNA sequence - synonymous substitutions -- no change in amino. acid identity ... trypsin (digestive enzyme) New genes via internal duplications: ...

synonymous substitutions -- no change in amino. acid identity ... trypsin (digestive enzyme) New genes via internal duplications: ...

| PowerPoint PPT presentation | free to view

MOLECULAR ECOLOGY AND EVOLUTION PowerPoint PPT Presentation

MOLECULAR ECOLOGY AND EVOLUTION - Concepts of partial gene duplication and gene shuffling become ... CLOT LYSIS. Plasmin: a serine protease (trypsin like) which specifically breaks down fibrin ...

Concepts of partial gene duplication and gene shuffling become ... CLOT LYSIS. Plasmin: a serine protease (trypsin like) which specifically breaks down fibrin ...

| PowerPoint PPT presentation | free to view

Molecular Clocks PowerPoint PPT Presentation

Molecular Clocks - Molecular Clocks Rose Hoberman The Holy Grail Fossil evidence is sparse and imprecise (or nonexistent) Given a phylogenetic tree branch lengths (rt) a time estimate ...

Molecular Clocks Rose Hoberman The Holy Grail Fossil evidence is sparse and imprecise (or nonexistent) Given a phylogenetic tree branch lengths (rt) a time estimate ...

| PowerPoint PPT presentation | free to download

Molecular clocks - Molecular clocks * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * The viroid is CChMVd.

Molecular clocks * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * The viroid is CChMVd.

| PowerPoint PPT presentation | free to download

DNA RNA - ... * Non-coding RNAs * RNA processing pre-RNA mature-RNA * Examples of RNA processing: 1. Capping of 5' end. 2. Polyadenylation of 3' end. 3.

... * Non-coding RNAs * RNA processing pre-RNA mature-RNA * Examples of RNA processing: 1. Capping of 5' end. 2. Polyadenylation of 3' end. 3.

| PowerPoint PPT presentation | free to download

Molecular Clocks - 110 MYA. Can we date other nodes in the tree? Yes... e.g. RNA viruses have. error-prone polymerases. Repair ... e.g. root-to-tip distances must be equal ...

110 MYA. Can we date other nodes in the tree? Yes... e.g. RNA viruses have. error-prone polymerases. Repair ... e.g. root-to-tip distances must be equal ...

| PowerPoint PPT presentation | free to view

Codon Usage - The relative adaptiveness of a codon (wi) is computed as. where RSCUmax = the RSCU value for the most frequently used codon for an amino acid. ...

The relative adaptiveness of a codon (wi) is computed as. where RSCUmax = the RSCU value for the most frequently used codon for an amino acid. ...

| PowerPoint PPT presentation | free to view

Mondrian, Pollock - Mondrian, Pollock

Mondrian, Pollock

| PowerPoint PPT presentation | free to view

Early Divergence Events PowerPoint PPT Presentation

Early Divergence Events - 'All the organic beings which have ever lived on this earth have descended from ... Sensitivity to. chloramphenicol, streptomycin and. kanamycin Growth at 80 C ...

'All the organic beings which have ever lived on this earth have descended from ... Sensitivity to. chloramphenicol, streptomycin and. kanamycin Growth at 80 C ...

| PowerPoint PPT presentation | free to view

Number of substitutions between two proteincoding genes PowerPoint PPT Presentation

Number of substitutions between two proteincoding genes - CCC (Pro) CCA (Pro) CAA (Gln) 1 synonymous and 1 nonsynonymous. Pathway II: CCC (Pro) CAC (His) CAA (Gln) 2 nonsynonymous. 10. Difficulties with numerator: ...

CCC (Pro) CCA (Pro) CAA (Gln) 1 synonymous and 1 nonsynonymous. Pathway II: CCC (Pro) CAC (His) CAA (Gln) 2 nonsynonymous. 10. Difficulties with numerator: ...

| PowerPoint PPT presentation | free to view

Weak forces in Evolution PowerPoint PPT Presentation

Weak forces in Evolution - Assortative mating is very strong in humans even with respect to non ... Per definition, the initial frequency of a mutation in a diploid population is 1/2N. ...

Assortative mating is very strong in humans even with respect to non ... Per definition, the initial frequency of a mutation in a diploid population is 1/2N. ...

| PowerPoint PPT presentation | free to view

PAML: Phylogenetic Analysis by Maximum Likelihood PowerPoint PPT Presentation

PAML: Phylogenetic Analysis by Maximum Likelihood - ML for amino acids & codons. The world's best named simulation program ... Uses of PAML (iv): Codon substitution models & detection of selection in protein ...

ML for amino acids & codons. The world's best named simulation program ... Uses of PAML (iv): Codon substitution models & detection of selection in protein ...

| PowerPoint PPT presentation | free to view

Genes, Genomes PowerPoint PPT Presentation

Genes, Genomes - Ampicillin. Tetracycline. Streak individual colonies with sterile toothpick. Incubate overnight. ... Ampicillin. Tetracycline. Q: Which colony is resistant to ...

Ampicillin. Tetracycline. Streak individual colonies with sterile toothpick. Incubate overnight. ... Ampicillin. Tetracycline. Q: Which colony is resistant to ...

| PowerPoint PPT presentation | free to view

Mutation - Mutations can occur in either somatic or germline cells. ... Vole. Barn swallow. mutation rate. mutation rate. fitness. fitness. 44. Spatial Distribution ...

Mutations can occur in either somatic or germline cells. ... Vole. Barn swallow. mutation rate. mutation rate. fitness. fitness. 44. Spatial Distribution ...

| PowerPoint PPT presentation | free to view

Adaptive Molecular Evolution PowerPoint PPT Presentation

Adaptive Molecular Evolution - There is a constant rate of molecular evolution. ... Maximum likelihood methods incorporate models of codon evolution / bias. Transition ...

There is a constant rate of molecular evolution. ... Maximum likelihood methods incorporate models of codon evolution / bias. Transition ...

| PowerPoint PPT presentation | free to download

Molecular Phylogeny PowerPoint PPT Presentation

Molecular Phylogeny - and Functional Genomics by Jonathan Pevsner Charles Darwin's theory of evolution. ... Was Darwin correct that humans are closest. to chimps and gorillas? ...

and Functional Genomics by Jonathan Pevsner Charles Darwin's theory of evolution. ... Was Darwin correct that humans are closest. to chimps and gorillas? ...

| PowerPoint PPT presentation | free to view

DNA RNA - The hereditary information of all living organisms, with the exception of some ... the suffix P is used, e.g., CA5P for the -carbonic anhydrase pseudogene 5. ...

The hereditary information of all living organisms, with the exception of some ... the suffix P is used, e.g., CA5P for the -carbonic anhydrase pseudogene 5. ...

| PowerPoint PPT presentation | free to view

Alternative splicing and gene duplication are interchangeable neofunctionalization mechanisms PowerPoint PPT Presentation

Alternative splicing and gene duplication are interchangeable neofunctionalization mechanisms - Puffer fish. Mouse. Human. Yeast. Fruit. Fly. HS DM. 1500. 990. 450. 90. HS ... In reference to: Mouse Puffer fish Fruit fly Yeast. Implied by this trend: ...

Puffer fish. Mouse. Human. Yeast. Fruit. Fly. HS DM. 1500. 990. 450. 90. HS ... In reference to: Mouse Puffer fish Fruit fly Yeast. Implied by this trend: ...

| PowerPoint PPT presentation | free to view

Introduction to Molecular Phylogeny PowerPoint PPT Presentation

Introduction to Molecular Phylogeny - Xenopus ATGCATGGGCCAACATGACCAGGAGTTGGTGTCGGTCCAAACAGCGTT---GGCTCTCTA ... Xenopus ATGCATGGGCCAACATGACCAGGAGTTGGTGTCggtCCAAACAGCGTT---GGCTCTCTA ...

Xenopus ATGCATGGGCCAACATGACCAGGAGTTGGTGTCGGTCCAAACAGCGTT---GGCTCTCTA ... Xenopus ATGCATGGGCCAACATGACCAGGAGTTGGTGTCggtCCAAACAGCGTT---GGCTCTCTA ...

| PowerPoint PPT presentation | free to download

Sequence analysis course PowerPoint PPT Presentation

Sequence analysis course - PAUP Phylip by Joe ... Sequence analysis course Author: pirovano Last modified by: heringa Created Date: 11/2/2005 9:49:40 AM Document presentation format: On ...

PAUP Phylip by Joe ... Sequence analysis course Author: pirovano Last modified by: heringa Created Date: 11/2/2005 9:49:40 AM Document presentation format: On ...

| PowerPoint PPT presentation | free to download

PROTEIN FORM AND FUNCTION PowerPoint PPT Presentation

PROTEIN FORM AND FUNCTION - Partial gene duplication results in gene elongation. HAPTOGLOBINS ... EXON/DOMAIN SHUFFLING. Dehydrogenases. Lactate dehydrogenase (LDH) Malate dehydrogenase (MDH) ...

Partial gene duplication results in gene elongation. HAPTOGLOBINS ... EXON/DOMAIN SHUFFLING. Dehydrogenases. Lactate dehydrogenase (LDH) Malate dehydrogenase (MDH) ...

| PowerPoint PPT presentation | free to view

Reconstruccin Filogentica PowerPoint PPT Presentation

Reconstruccin Filogentica - DATOS: Alineamiento de secuencias de genes ... Maximum likelihood or model ... clustering with the Unweighted Pair Group Method with Arithmatic Mean (UPGMA) ...

DATOS: Alineamiento de secuencias de genes ... Maximum likelihood or model ... clustering with the Unweighted Pair Group Method with Arithmatic Mean (UPGMA) ...

| PowerPoint PPT presentation | free to view

Molecular Clocks - Evolution at the molecular level is radically different from evolution at the ... Darwin's theory reinterpreted homology as common ancestry. ATCGGCCACTTTCGCGATCA ...

Evolution at the molecular level is radically different from evolution at the ... Darwin's theory reinterpreted homology as common ancestry. ATCGGCCACTTTCGCGATCA ...

| PowerPoint PPT presentation | free to view

A Fast Algorithm for Joint Reconstruction of Ancestral Amino Acid Sequences PowerPoint PPT Presentation

A Fast Algorithm for Joint Reconstruction of Ancestral Amino Acid Sequences - A Fast Algorithm for Joint Reconstruction of Ancestral Amino Acid ... Raymond Beverly Sackler Faculty of Exact Sciences. Tel Aviv University, Ramat Aviv, Israel ...

A Fast Algorithm for Joint Reconstruction of Ancestral Amino Acid ... Raymond Beverly Sackler Faculty of Exact Sciences. Tel Aviv University, Ramat Aviv, Israel ...

| PowerPoint PPT presentation | free to view

Evolutionary Change in Nucleotide Sequences PowerPoint PPT Presentation

Evolutionary Change in Nucleotide Sequences - For example, if we start with a sequence made of adenines only, then PA(0) = 1, ... The expected frequency of A in the sequence at equilibrium will be 1/4, and so ...

For example, if we start with a sequence made of adenines only, then PA(0) = 1, ... The expected frequency of A in the sequence at equilibrium will be 1/4, and so ...

| PowerPoint PPT presentation | free to view

Alternative splicing: A playground of evolution PowerPoint PPT Presentation

Alternative splicing: A playground of evolution - ... exons still may seem to be conserved in the rodent lineage due to short time ... obtain the number (fraction) of real rodent-specific exons (dark green) ...

... exons still may seem to be conserved in the rodent lineage due to short time ... obtain the number (fraction) of real rodent-specific exons (dark green) ...

| PowerPoint PPT presentation | free to download

Introduction to Bioinformatics PowerPoint PPT Presentation

Introduction to Bioinformatics - ... Stuart Stephen, W. James Kent, John S. Mattick, & David Haussler (Science 2004. ... First Name: John. Last name: Travolta. Course: Ballet 2001; Ballet 2002; ...

... Stuart Stephen, W. James Kent, John S. Mattick, & David Haussler (Science 2004. ... First Name: John. Last name: Travolta. Course: Ballet 2001; Ballet 2002; ...

| PowerPoint PPT presentation | free to view

Pr - Title: Pr sentation PowerPoint Author: Fredj Tekaia Last modified by: Utilisateur de la version d' valuation de Office 2004 Created Date: 5/28/2003 8:48:40 PM

Title: Pr sentation PowerPoint Author: Fredj Tekaia Last modified by: Utilisateur de la version d' valuation de Office 2004 Created Date: 5/28/2003 8:48:40 PM

| PowerPoint PPT presentation | free to view

Introduction to Molecular Phylogeny - Starting point: a set of homologous, aligned DNA or protein sequences ... Phylogenetic tree of the Bcl-2 family derived from the NJ method applied to PAM ...

Starting point: a set of homologous, aligned DNA or protein sequences ... Phylogenetic tree of the Bcl-2 family derived from the NJ method applied to PAM ...

| PowerPoint PPT presentation | free to download

The Darwinian Genome: Genetic and Molecular Evidence for Evolution - The Darwinian Genome: Genetic and Molecular Evidence for Evolution

The Darwinian Genome: Genetic and Molecular Evidence for Evolution

| PowerPoint PPT presentation | free to view

Human Genetic Variations PowerPoint PPT Presentation

Human Genetic Variations - Probability distribution of A allele in a population of 100 and random ... Allele frequencies among populations were summarized by principal components. ...

Probability distribution of A allele in a population of 100 and random ... Allele frequencies among populations were summarized by principal components. ...

| PowerPoint PPT presentation | free to view

Constructing Phylogenies from Quartets: Elucidation of Eutherian Superordinal Relationships PowerPoint PPT Presentation

Constructing Phylogenies from Quartets: Elucidation of Eutherian Superordinal Relationships - Computation Theory Lab, CSIE, CCU, Taiwan. 3. Evolutionary trees ... O(nn2) possible evolutionary trees. 11/11/09. Computation Theory Lab, CSIE, CCU, Taiwan ...

Computation Theory Lab, CSIE, CCU, Taiwan. 3. Evolutionary trees ... O(nn2) possible evolutionary trees. 11/11/09. Computation Theory Lab, CSIE, CCU, Taiwan ...

| PowerPoint PPT presentation | free to view

Molecular Evolution: Plan for week PowerPoint PPT Presentation

Molecular Evolution: Plan for week - Molecular Evolution: Plan for week Monday 3.11: Basics of Molecular Evolution Lecture 1: 9-10.30 Molecular Basis and Models I (JH) Computer : 11-12.30 PAUP ...

Molecular Evolution: Plan for week Monday 3.11: Basics of Molecular Evolution Lecture 1: 9-10.30 Molecular Basis and Models I (JH) Computer : 11-12.30 PAUP ...

| PowerPoint PPT presentation | free to download

Recursive Self-Improvement, and the World PowerPoint PPT Presentation

Recursive Self-Improvement, and the World - Other stuff that happens in the brain: Social persuasion. Enthusiasm. Reading faces ... try to heal the sick. incest taboos. true distinguished from false ...

Other stuff that happens in the brain: Social persuasion. Enthusiasm. Reading faces ... try to heal the sick. incest taboos. true distinguished from false ...

| PowerPoint PPT presentation | free to view

The Neutral Mutation Theory of Molecular Evolution PowerPoint PPT Presentation

The Neutral Mutation Theory of Molecular Evolution - The most recent common ancestor of human and mouse lived about 75 million years ago. ... How many deaths are required to bring about a substitution? ...

The most recent common ancestor of human and mouse lived about 75 million years ago. ... How many deaths are required to bring about a substitution? ...

| PowerPoint PPT presentation | free to view

Pr - ... mutations, is that many mutations will have deleterious effects on fitness. ... 'Purifying selection' is a natural selection against deleterious mutations. ...

... mutations, is that many mutations will have deleterious effects on fitness. ... 'Purifying selection' is a natural selection against deleterious mutations. ...

| PowerPoint PPT presentation | free to view

Admin - Molecular systematics is the study of various methods that can be used to ... Test 1 23/8 14:00. Test 2 20/9 14:00. Test 3 & Prac 11/10 14:00. Report 18/10 14:00 ...

Molecular systematics is the study of various methods that can be used to ... Test 1 23/8 14:00. Test 2 20/9 14:00. Test 3 & Prac 11/10 14:00. Report 18/10 14:00 ...

| PowerPoint PPT presentation | free to view

Graur PowerPoint PPT Presentations