92 Biocyc PPTs View free & download

Pathway Tools / BioCyc Fundamentals PowerPoint PPT Presentation

Pathway Tools / BioCyc Fundamentals - Pathway Tools / BioCyc Fundamentals Peter D. Karp, Ph.D. Bioinformatics Research Group SRI International pkarp@ai.sri.com BioCyc.org EcoCyc.org, MetaCyc.org, HumanCyc.org

Pathway Tools / BioCyc Fundamentals Peter D. Karp, Ph.D. Bioinformatics Research Group SRI International pkarp@ai.sri.com BioCyc.org EcoCyc.org, MetaCyc.org, HumanCyc.org

| PowerPoint PPT presentation | free to view

The BioCyc Collection of PathwayGenome Databases PowerPoint PPT Presentation

The BioCyc Collection of PathwayGenome Databases - Acids. Res. 33:D334 2005 ASM News 70:25 2004 Science 293:2040 ... Nucleic Acids Research 34:D511-D516 2006. SRI International. Bioinformatics. Comparative Tools ...

Acids. Res. 33:D334 2005 ASM News 70:25 2004 Science 293:2040 ... Nucleic Acids Research 34:D511-D516 2006. SRI International. Bioinformatics. Comparative Tools ...

| PowerPoint PPT presentation | free to download

BioWarehouse: A Bioinformatics Database Warehouse PowerPoint PPT Presentation

BioWarehouse: A Bioinformatics Database Warehouse - A Bioinformatics Database Warehouse Peter D. Karp, Thomas J. Lee, Valerie Wagner BioCyc BioPAX BioCyc ENZYME CMR Genbank BioWarehouse Eco2DBase Oracle (10g) or

A Bioinformatics Database Warehouse Peter D. Karp, Thomas J. Lee, Valerie Wagner BioCyc BioPAX BioCyc ENZYME CMR Genbank BioWarehouse Eco2DBase Oracle (10g) or

| PowerPoint PPT presentation | free to download

Improving Gene Function Prediction Using Gene Neighborhoods PowerPoint PPT Presentation

Improving Gene Function Prediction Using Gene Neighborhoods - http://biocyc.org:1555/ECOLI/new-image?object=Transcription-Units ... http://biocyc.org:1555/ECOLI/new-image?type=OPERON&object=TU00206. Case 2 : Rbs Operon ...

http://biocyc.org:1555/ECOLI/new-image?object=Transcription-Units ... http://biocyc.org:1555/ECOLI/new-image?type=OPERON&object=TU00206. Case 2 : Rbs Operon ...

| PowerPoint PPT presentation | free to view

Introduction to PDB Workshop From Molecules to Medicine: Integrating Crystallography in Drug Discove PowerPoint PPT Presentation

Introduction to PDB Workshop From Molecules to Medicine: Integrating Crystallography in Drug Discove - To provide a global resource for the advancement of ... SCOP/CATH. BioCyc. Pfam. Reactome. Enzyme Classification. PubMed. GeneRIF. IHOP. Abstract search ...

To provide a global resource for the advancement of ... SCOP/CATH. BioCyc. Pfam. Reactome. Enzyme Classification. PubMed. GeneRIF. IHOP. Abstract search ...

| PowerPoint PPT presentation | free to view

Administering Pathway Tools PowerPoint PPT Presentation

Administering Pathway Tools - To obtain license agreement go to BioCyc.org and click on Software/Database Download ... Releases announced on ptools-users@ai.sri.com. Read release notes at ...

To obtain license agreement go to BioCyc.org and click on Software/Database Download ... Releases announced on ptools-users@ai.sri.com. Read release notes at ...

| PowerPoint PPT presentation | free to download

Pathway%20Tools%20User%20Group%20Meeting%20Introduction PowerPoint PPT Presentation

Pathway%20Tools%20User%20Group%20Meeting%20Introduction - Read the release notes! SRI International. Bioinformatics. Behind the Scenes. 330,000 lines of code, mostly Common Lisp. 4.5 programmers ...

Read the release notes! SRI International. Bioinformatics. Behind the Scenes. 330,000 lines of code, mostly Common Lisp. 4.5 programmers ...

| PowerPoint PPT presentation | free to download

gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta PowerPoint PPT Presentation

gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta - Title: 1 Author: Rahmaninova Last modified by: ravcheyev Created Date: 2/9/2006 1:13:17 PM Document presentation format: On-screen Show Company

Title: 1 Author: Rahmaninova Last modified by: ravcheyev Created Date: 2/9/2006 1:13:17 PM Document presentation format: On-screen Show Company

| PowerPoint PPT presentation | free to download

AraCyc and the OMICS Viewer: Making sense of metabolism in your favorite biological process PowerPoint PPT Presentation

AraCyc and the OMICS Viewer: Making sense of metabolism in your favorite biological process - Everyone is studying metabolism Many biological processes connect to metabolism Drought tolerance ... in wild-type and mutant plants using the OMICS viewer Look ...

Everyone is studying metabolism Many biological processes connect to metabolism Drought tolerance ... in wild-type and mutant plants using the OMICS viewer Look ...

| PowerPoint PPT presentation | free to view

The EcoCyc and MetaCyc Pathway/Genome Databases PowerPoint PPT Presentation

The EcoCyc and MetaCyc Pathway/Genome Databases - Ocelot Storage System Architecture. Persistent storage via disk files, Oracle DBMS ... DBMS is submerged within Ocelot, invisible to users ...

Ocelot Storage System Architecture. Persistent storage via disk files, Oracle DBMS ... DBMS is submerged within Ocelot, invisible to users ...

| PowerPoint PPT presentation | free to download

Comprehensive Identification of Conditionally Essential Genes in Mycobacteria PowerPoint PPT Presentation

Comprehensive Identification of Conditionally Essential Genes in Mycobacteria - PCR based mutagenesis. Signature tagged mutagenesis (STM) ... Signature Tagged Mutagenesis (STM) Nature Reviews Genetics 7:929-939 (2006) ...

PCR based mutagenesis. Signature tagged mutagenesis (STM) ... Signature Tagged Mutagenesis (STM) Nature Reviews Genetics 7:929-939 (2006) ...

| PowerPoint PPT presentation | free to view

The Pathway/Genome Navigator - The Pathway/Genome Navigator

The Pathway/Genome Navigator

| PowerPoint PPT presentation | free to download

The Ocelot Frame Knowledge Representation System PowerPoint PPT Presentation

The Ocelot Frame Knowledge Representation System - ... Knowledge Representation Systems. Long history of development in the AI knowledge ... Aka DB, Knowledge Base, KB, PGDB. An Ocelot database is a ...

... Knowledge Representation Systems. Long history of development in the AI knowledge ... Aka DB, Knowledge Base, KB, PGDB. An Ocelot database is a ...

| PowerPoint PPT presentation | free to download

Digital Cells Nano-Bio-Info Technology PowerPoint PPT Presentation

Digital Cells Nano-Bio-Info Technology - Digital Cells Nano-Bio-Info Technology Introduction to Nanotechnology Image by John Alsop Outline Concept of a gene (extended) Gene Regulatory Networks (GRN) GRN and ...

Digital Cells Nano-Bio-Info Technology Introduction to Nanotechnology Image by John Alsop Outline Concept of a gene (extended) Gene Regulatory Networks (GRN) GRN and ...

| PowerPoint PPT presentation | free to download

Bio-Trac 25 (Proteomics: Principles and Methods) PowerPoint PPT Presentation

Bio-Trac 25 (Proteomics: Principles and Methods) - Molecular Biology Database Collection (http://nar.oupjournals.org/cgi/content ... WIT: Functional Curation and Metabolic Models. BRENDA: Enzyme Database ...

Molecular Biology Database Collection (http://nar.oupjournals.org/cgi/content ... WIT: Functional Curation and Metabolic Models. BRENDA: Enzyme Database ...

| PowerPoint PPT presentation | free to view

Bio-Trac 25 (Proteomics: Principles and Methods) - Title: Protein Family Classification for Functional Genomics Author: wuc Last modified by: zh9 Created Date: 3/9/2001 10:06:29 PM Document presentation format

Title: Protein Family Classification for Functional Genomics Author: wuc Last modified by: zh9 Created Date: 3/9/2001 10:06:29 PM Document presentation format

| PowerPoint PPT presentation | free to view

Pathway (Network) Informatics @ MSKCC PowerPoint PPT Presentation

Pathway (Network) Informatics @ MSKCC - 3 research staff, 1 developer, 1 computing, 3 admin. Visiting Faculty: Jose Vilar ... Grants. Department of Energy. BioPAX. BioPAX = Biological Pathway Exchange ...

3 research staff, 1 developer, 1 computing, 3 admin. Visiting Faculty: Jose Vilar ... Grants. Department of Energy. BioPAX. BioPAX = Biological Pathway Exchange ...

| PowerPoint PPT presentation | free to view

Equinox Pharma Ltd PowerPoint PPT Presentation

Equinox Pharma Ltd - CISBIC Sub-project 1: Modeling genotype-phenotype relations in Campylobacter Stephen Muggleton, Brendan Wren, Victor Lesk CISBIC, Imperial College London.

CISBIC Sub-project 1: Modeling genotype-phenotype relations in Campylobacter Stephen Muggleton, Brendan Wren, Victor Lesk CISBIC, Imperial College London.

| PowerPoint PPT presentation | free to view

Overview of the Pathway Tools Software and Pathway/Genome Databases PowerPoint PPT Presentation

Overview of the Pathway Tools Software and Pathway/Genome Databases - What do you hope to get out of the tutorial? SRI International. Bioinformatics. SRI ... Mike McLeod, University of British Columbia, Rhodococcus sp. RHA1 ...

What do you hope to get out of the tutorial? SRI International. Bioinformatics. SRI ... Mike McLeod, University of British Columbia, Rhodococcus sp. RHA1 ...

| PowerPoint PPT presentation | free to download

Administering Pathway Tools - Obtaining Pathway Tools. Free for non-commercial use. To obtain license ... Napster Comes to Bioinformatics. Public sharing of Pathway/Genome Databases ...

Obtaining Pathway Tools. Free for non-commercial use. To obtain license ... Napster Comes to Bioinformatics. Public sharing of Pathway/Genome Databases ...

| PowerPoint PPT presentation | free to download

Protein Pathways and Pathway Databases PowerPoint PPT Presentation

Protein Pathways and Pathway Databases - All pathways are networks of interactions, however not all networks are ... Chemical substructure comparison. Enzymes,Transcription Factors. Genes: Blast search ...

All pathways are networks of interactions, however not all networks are ... Chemical substructure comparison. Enzymes,Transcription Factors. Genes: Blast search ...

| PowerPoint PPT presentation | free to view

pyruvate decarboxylase PowerPoint PPT Presentation

pyruvate decarboxylase - 1

1

| PowerPoint PPT presentation | free to download

BioPAX A Data Exchange Format for Biological Pathways PowerPoint PPT Presentation

BioPAX A Data Exchange Format for Biological Pathways - Provide a consistent data exchange format to make it easier for ... 0.4 kcal/mole. Delta G cml fructose-6-phosphate /cml Right cml glucose-6-phosphate /cml ...

Provide a consistent data exchange format to make it easier for ... 0.4 kcal/mole. Delta G cml fructose-6-phosphate /cml Right cml glucose-6-phosphate /cml ...

| PowerPoint PPT presentation | free to view

Overview - Currently, not much overlap between published interaction datasets. Most confidence given to observed interactions with other supporting evidence. ...

Currently, not much overlap between published interaction datasets. Most confidence given to observed interactions with other supporting evidence. ...

| PowerPoint PPT presentation | free to download

Update on The Pathway Tools Software PowerPoint PPT Presentation

Update on The Pathway Tools Software - Chemical substructure comparison. Enzymes, Transporters, ... Query compounds by name, MW, formula, substructure. Reference list displayed at bottom of page ...

Chemical substructure comparison. Enzymes, Transporters, ... Query compounds by name, MW, formula, substructure. Reference list displayed at bottom of page ...

| PowerPoint PPT presentation | free to view

Practice retrieving data and running stand alone BLAST. PowerPoint PPT Presentation

Practice retrieving data and running stand alone BLAST. - Practice retrieving data and running stand alone BLAST. ... Solanum pennellii (EST) Query: Select Pathway by name. Enter: Abscisic Acid. Submit ...

Practice retrieving data and running stand alone BLAST. ... Solanum pennellii (EST) Query: Select Pathway by name. Enter: Abscisic Acid. Submit ...

| PowerPoint PPT presentation | free to download

WWW Server Operation PowerPoint PPT Presentation

WWW Server Operation - Comparative Genomics Tools (HTML Tables) Advanced Query Tool, using BioVelo. BLAST Searching ... Starting WWW Server: Basics. Configured by ptools-init.dat parameters ...

Comparative Genomics Tools (HTML Tables) Advanced Query Tool, using BioVelo. BLAST Searching ... Starting WWW Server: Basics. Configured by ptools-init.dat parameters ...

| PowerPoint PPT presentation | free to download

Microbial Research Commons Including Viruses PowerPoint PPT Presentation

Microbial Research Commons Including Viruses - Microbial Research Commons Including Viruses Prof. A.S. Kolaskar Bioinformatics Center University of Pune Pune, India

Microbial Research Commons Including Viruses Prof. A.S. Kolaskar Bioinformatics Center University of Pune Pune, India

| PowerPoint PPT presentation | free to download

Writing Programs that Analyze PathwayGenome Databases PowerPoint PPT Presentation

Writing Programs that Analyze PathwayGenome Databases - Types of Credit: Created, Reviewed, Revised. Home Pages for Authors ... used for Stoichiometry Coefficients, Compartments, Citations, etc. Principal Classes 1 ...

Types of Credit: Created, Reviewed, Revised. Home Pages for Authors ... used for Stoichiometry Coefficients, Compartments, Citations, etc. Principal Classes 1 ...

| PowerPoint PPT presentation | free to download

Overview of Genome Databases PowerPoint PPT Presentation

Overview of Genome Databases - Definition of Bioinformatics ... For many years, the majority of bioinformatics DBs did not employ a DBMS ... Warehouse schema defines many bioinformatics datatypes ...

Definition of Bioinformatics ... For many years, the majority of bioinformatics DBs did not employ a DBMS ... Warehouse schema defines many bioinformatics datatypes ...

| PowerPoint PPT presentation | free to download

Programming Computers - Programming Computers

Programming Computers

| PowerPoint PPT presentation | free to download

Submitting%20pathway%20to%20MetaCyc PowerPoint PPT Presentation

Submitting%20pathway%20to%20MetaCyc - Why Curate a PGDB? A well curated PGDB can serve as a central online resource that integrates many ... Curate full information for enzymes and genes. ...

Why Curate a PGDB? A well curated PGDB can serve as a central online resource that integrates many ... Curate full information for enzymes and genes. ...

| PowerPoint PPT presentation | free to download

got genome? - GMOD has several choices for creating web-accessible biological ... running and reusing custom pipelines on one or a cluster of computers ... PowerPoint Presentation ...

GMOD has several choices for creating web-accessible biological ... running and reusing custom pipelines on one or a cluster of computers ... PowerPoint Presentation ...

| PowerPoint PPT presentation | free to download

BioPAX The Birth of A Data Exchange Language for Biological Pathways PowerPoint PPT Presentation

BioPAX The Birth of A Data Exchange Language for Biological Pathways - BOF Sunday. 30 July 2004. 7th BioOntologies Workshop. 20. BioPAX Supporting Groups. Groups ... Low Detail High Detail. 30 July 2004. 7th BioOntologies Workshop. 23 ...

BOF Sunday. 30 July 2004. 7th BioOntologies Workshop. 20. BioPAX Supporting Groups. Groups ... Low Detail High Detail. 30 July 2004. 7th BioOntologies Workshop. 23 ...

| PowerPoint PPT presentation | free to view

BioPAX Biological Pathway Data Exchange Format PowerPoint PPT Presentation

BioPAX Biological Pathway Data Exchange Format - Arguably the most accessible data source, but... Varied formats, representation, coverage ... 7pm - Dinner at Trellis Italian restaurant. Agenda - Day 2 ...

Arguably the most accessible data source, but... Varied formats, representation, coverage ... 7pm - Dinner at Trellis Italian restaurant. Agenda - Day 2 ...

| PowerPoint PPT presentation | free to view

BioTrac 25 Proteomics: Principles and Methods - BioTrac 25 Proteomics: Principles and Methods

BioTrac 25 Proteomics: Principles and Methods

| PowerPoint PPT presentation | free to view

Making Sense Out of Transcriptome Integrative Bioinformatic Approaches - Making Sense Out of Transcriptome Integrative Bioinformatic Approaches

Making Sense Out of Transcriptome Integrative Bioinformatic Approaches

| PowerPoint PPT presentation | free to view

Synthetic Biology (The Cell as a Nanosystem) PowerPoint PPT Presentation

Synthetic Biology (The Cell as a Nanosystem) - Synthetic Biology (The Cell as a Nanosystem) ARC Bioinformatics UC Davis Summer 2006 Synthetic Biology Nanotechnology is emulating biology Molecular assemblers ...

Synthetic Biology (The Cell as a Nanosystem) ARC Bioinformatics UC Davis Summer 2006 Synthetic Biology Nanotechnology is emulating biology Molecular assemblers ...

| PowerPoint PPT presentation | free to download

BioPAX A Data Exchange Format for Biological Pathways - An open source community effort to build a data exchange format for biological pathways ... University of Colorado Health Sciences Center: I. Shah ...

An open source community effort to build a data exchange format for biological pathways ... University of Colorado Health Sciences Center: I. Shah ...

| PowerPoint PPT presentation | free to view

Recent Developments in Pathway Tools GMOD Workshop November 07 PowerPoint PPT Presentation

Recent Developments in Pathway Tools GMOD Workshop November 07 - Taxonomic pruning reduces false positive pathway predictions ... variants in MetaCyc mean potentially many false positive pathway predictions ...

Taxonomic pruning reduces false positive pathway predictions ... variants in MetaCyc mean potentially many false positive pathway predictions ...

| PowerPoint PPT presentation | free to view

Combine knowledge, data, and tools to PowerPoint PPT Presentation

Combine knowledge, data, and tools to - Integrates Genomic and Data Analysis Tools ... phycocyanin associated linker protein (cpcC) OmpR subfamily. hypothetical protein (atp1) ...

Integrates Genomic and Data Analysis Tools ... phycocyanin associated linker protein (cpcC) OmpR subfamily. hypothetical protein (atp1) ...

| PowerPoint PPT presentation | free to view

Overview - Overview Introduction Biological network data Text mining Gene Ontology Expression data basics Expression, text mining, and GO Modules and complexes

Overview Introduction Biological network data Text mining Gene Ontology Expression data basics Expression, text mining, and GO Modules and complexes

| PowerPoint PPT presentation | free to download

BIO-TRAC 25 (Proteomics: Principles and Methods) - Transmembrane Helix: TMHMM, TMAP. 2D Prediction (a-helix, b-sheet, Coiled-coils): PHD, JPred ... Transmembrane Helix (http://www.cbs.dtu.dk/services/TMHMM/) 29 ...

Transmembrane Helix: TMHMM, TMAP. 2D Prediction (a-helix, b-sheet, Coiled-coils): PHD, JPred ... Transmembrane Helix (http://www.cbs.dtu.dk/services/TMHMM/) 29 ...

| PowerPoint PPT presentation | free to download

Seminar Presentation PowerPoint PPT Presentation

Seminar Presentation - Discovery of New Regulatory Motifs of Purine Biosynthetic ... MACAW. Run AlignACE and MEME. 100, 300 bp Upstream Databases. AlignACE. MEME. Motifs. ScanACE ...

Discovery of New Regulatory Motifs of Purine Biosynthetic ... MACAW. Run AlignACE and MEME. 100, 300 bp Upstream Databases. AlignACE. MEME. Motifs. ScanACE ...

| PowerPoint PPT presentation | free to view

Methods - The Sorcerer II Global Ocean Sampling Expedition: Metagenomic Characterization of Viruses within Aquatic Microbial Samples Shannon J. Williamson, Douglas B. Rusch ...

The Sorcerer II Global Ocean Sampling Expedition: Metagenomic Characterization of Viruses within Aquatic Microbial Samples Shannon J. Williamson, Douglas B. Rusch ...

| PowerPoint PPT presentation | free to download

A tool for metabolic and regulatory pathways visual analysis PowerPoint PPT Presentation

A tool for metabolic and regulatory pathways visual analysis - Biologists aim at identifying these roles, described as networks of interactions ... Develop an independent application based on batik ...

Biologists aim at identifying these roles, described as networks of interactions ... Develop an independent application based on batik ...

| PowerPoint PPT presentation | free to view

Pathway Tools: Recent Developments PowerPoint PPT Presentation

Pathway Tools: Recent Developments - RGD (Rat), Medical College of Wisconsin. WormBase (C. elegans), Caltech. Large scale users: ... Will use dictionary of biomedical terms. New sequence retrieval dialog ...

RGD (Rat), Medical College of Wisconsin. WormBase (C. elegans), Caltech. Large scale users: ... Will use dictionary of biomedical terms. New sequence retrieval dialog ...

| PowerPoint PPT presentation | free to view

Medical Informatics PowerPoint PPT Presentation

Medical Informatics - ... Unified Medical Language System (UMLS) Gene World Biomedical World Molecular Function = elemental activity/task the tasks performed by individual gene products; ...

... Unified Medical Language System (UMLS) Gene World Biomedical World Molecular Function = elemental activity/task the tasks performed by individual gene products; ...

| PowerPoint PPT presentation | free to download

OEChem in PubChem: Cleaning Up PDB Small Molecules PowerPoint PPT Presentation

OEChem in PubChem: Cleaning Up PDB Small Molecules - OEChem's Valence Model. Phosphorus with valence 4 can be /- 1. Valence Model (cont'd) Oxygen 1 is allowed valence 3, 5. PDB's HET. PDB sometimes splits into ...

OEChem's Valence Model. Phosphorus with valence 4 can be /- 1. Valence Model (cont'd) Oxygen 1 is allowed valence 3, 5. PDB's HET. PDB sometimes splits into ...

| PowerPoint PPT presentation | free to view

GO based data analysis PowerPoint PPT Presentation

GO based data analysis - All tools and materials from this workshop are available online at the AgBase ... Rosetta stone method. Text mining. TAP assays. Yeast two hybrid (Y2H) Protein arrays ...

All tools and materials from this workshop are available online at the AgBase ... Rosetta stone method. Text mining. TAP assays. Yeast two hybrid (Y2H) Protein arrays ...

| PowerPoint PPT presentation | free to view

Synthetic Biology The Cell as a Nanosystem - With our gene synthesis process you can get synthetic DNA that conforms exactly ... Stem cell and gene therapy synergism. Role of Bioinformatics. Where are genes? ...

With our gene synthesis process you can get synthetic DNA that conforms exactly ... Stem cell and gene therapy synergism. Role of Bioinformatics. Where are genes? ...

| PowerPoint PPT presentation | free to view

Recent Developments and Future Directions in Pathway Tools Peter D. Karp SRI International PowerPoint PPT Presentation

Recent Developments and Future Directions in Pathway Tools Peter D. Karp SRI International - Marvin chemical editor available. Embed hyperlinks to PGDB objects within comments ... Windows port. SRI International. Bioinformatics. Recent Developments ...

Marvin chemical editor available. Embed hyperlinks to PGDB objects within comments ... Windows port. SRI International. Bioinformatics. Recent Developments ...

| PowerPoint PPT presentation | free to download

BioWarehouse: The BioSPICE Bioinformatics Database Warehouse PowerPoint PPT Presentation

BioWarehouse: The BioSPICE Bioinformatics Database Warehouse - Create a toolkit for integrating a set of bioinformatics databases into one ... Representational tricks to decrease schema bloat. Single space of primary keys ...

Create a toolkit for integrating a set of bioinformatics databases into one ... Representational tricks to decrease schema bloat. Single space of primary keys ...

| PowerPoint PPT presentation | free to view

Medical Informatics - BMC Bioinformatics 8(1): 392 [Epub ahead of print] Applications: For functional enrichment For candidate gene prioritization Why another gene prioritization method?

BMC Bioinformatics 8(1): 392 [Epub ahead of print] Applications: For functional enrichment For candidate gene prioritization Why another gene prioritization method?

| PowerPoint PPT presentation | free to download

I keep six honest serving-men (They taught me all I knew); PowerPoint PPT Presentation

I keep six honest serving-men (They taught me all I knew); - I keep six honest serving-men (They taught me all I knew); Their names are What , and Why, and When, And How, and Where, and ...

I keep six honest serving-men (They taught me all I knew); Their names are What , and Why, and When, And How, and Where, and ...

| PowerPoint PPT presentation | free to download

BioPAX A Data Exchange Format for Biological Pathways - ... the amount of time spent on data integration in the bioinformatics community. ... SRI Bioinformatics Research Group: P. Karp, S. Paley, J. Pick ...

... the amount of time spent on data integration in the bioinformatics community. ... SRI Bioinformatics Research Group: P. Karp, S. Paley, J. Pick ...

| PowerPoint PPT presentation | free to view

Biocyc PowerPoint PPT Presentations